Skip to main content
Addgene

We narrowed to 33 results for: TDT

Showing: 1 - 20 of 33 results
  1. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...Boyden AV-1-PV3447 59171-AAV1 pAAV-Syn-ChrimsonR-tdT Optogenetics Ed Boyden AV-2-26969P 26969-AAV2 pAAV-CaMKIIa-hChR2...Boyden AV-5-PV3447 59171-AAV5 pAAV-Syn-ChrimsonR-tdT Optogenetics Ed Boyden AV-5-PV3638 65014-AAV5 pAAV-hsyn-Jaws-KGC-GFP-ER2...Boyden AV-9-PV3447 59171-AAV9 pAAV-Syn-ChrimsonR-tdT Optogenetics Ed Boyden AV-5-PV4618 100889-AAV5 pAAV.GfaABC1D.GluSnFr.SV40... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...100048-AAV1 pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-9-ALL856 100048-AAV9 pAAV.CAG.LSL.tdTomato Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Control Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV.PI.EGFP.WPRE.bGH...Wilson AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-...
  2. Optogenetics AAV Preps

    Type
    Collection
    ..., rg* Boyden 59171 pAAV-Syn-ChrimsonR-tdT Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc...ChrimsonR-tdTomato] Syn ChrimsonR tdTomato Cre dependent 1, 5 Boyden 62726 pAAV-Syn-Chronos-tdTomato Syn Chronos...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2... Chronos tdTomato Constitutive 8 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Boyden 105669...
  3. Teaching an Old DOG New Tricks: Controlling Protein Activity with GFP

    Type
    Blog Post
    ...used red fluorescent proteins dsRed, mCherry, and TdTomato do not induce transcription. Thus, T-DDOGs can...expression robustly activated the reporter gene TdTomato, whose expression was absent without electroporated...T-DDOGs with two mouse GFP reporter lines; again, TdTomato was seen only in cells with GFP, at a high activation...frequency of 56-93%. In the converse test, 98% of TdTomato expressing cells were GFP+, indicating a robust...
  4. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ...pAAV-Ef1a-fDIO-ChrimsonR-tdTomato AAV9 Controls Jensen New serotype pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA AAV9...multiple serotypes pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] AAV5, AAV8 Optogenetics Boyden New serotypes...
  5. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ...pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] pAAV-FLEX-tdTomato pAAV-GFAP104-mCherry pAAV-mDlx-NLS-mRuby2 CAG-...fluorescent-tagged molecular tool.   Find pAAV-FLEX-tdTomato, pAAV-GFAP104-mCherry, pAAV-mDlx-NLS-mRuby2, CAG-NLS-GFP... pAAV-hSyn-DIO-mCherry 59462  AAV2  pAAV-CAG-tdTomato (codon diversified) 37825  AAV8*, AAV9*  pAAV-CAG-GFP...
  6. Newly Updated AAV Data Hub!

    Type
    Blog Post
    ...AAV1 Cre virus combined with a Cre-dependent AAV9 tdTomato virus in the mPFC.  The AAV9 is so strong that...
  7. New Viral Vectors - Fall 2024

    Type
    Blog Post
    ...multiple serotypes pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] AAV1 Optogenetics Edward Boyden New serotype ...
  8. Hot Plasmids - October 2022

    Type
    Blog Post
    ... cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse. C) Action...
  9. New Viral Vectors - Winter 2025

    Type
    Blog Post
    ...Roth New serotype pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato AAV8 Molecular tool Massimo Scanziani New viral...
  10. Sequencing Primers

    Type
    Guide
    ...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...TCTTTGATGACGGCCATGT 5' end of tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance...
Showing: 1 - 20 of 33 results