Skip to main content

We narrowed to 6 results for: Toxoplasma gondii

Showing: 1 - 6 of 6 results
  1. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...apicomplexan organism Toxoplasma gondii to the infection of human fibroblasts. Toxoplasma mutants were generated...Mülleder M, et al. F1000Res. PubMed PMID: 27830062 Toxoplasma CRISPR knockout pooled library Parasites from...ten guides against each of the 8,158 predicted T. gondii protein-coding genes). Dr. Lourido’s studies demonstrate...conserved among apicomplexans and important for T. gondii fitness. Sixteen of these genes were investigated...shown to be important for the initiation of the T. gondii infection, and necessary for the asexual cycle ...
  2. CRISPR Plasmids - Parasites

    Type
    Collection
    ...Publication Libraries Toxoplasma CRISPR Knockout Pooled Library - Toxoplasma gondii CRISPR genome-wide knockout...world. Parasites such as Plasmodium (malaria), Toxoplasma (toxoplasmosis), Trypanosoma (African sleeping...
  3. Microbiology Resources

    Type
    Collection
    ...histolytica Leishmania sp. Plasmodium sp. Toxoplasma gondii Trypanosoma sp. Plasmids for Viruses Species...
  4. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... Ebert pSAG1::CAS9-U6::sgUPRT 54467 Other/Toxoplasma gondii none, Q5 mutagenesis yes, cut S. pyogenes ...pyogenes Sibley pU6-Universal 52694 Other/Toxoplasma gondii BsaI yes, cut S. pyogenes Lourido pRGE31 50929 Plant...
  5. Validated gRNA Sequences

    Type
    Collection
    ...48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...cut S. pyogenes 26480473 Wolfe TGME49_290860 T. gondii ATTGGTCTGACAGCGATGTG 59855 cut S. pyogenes 25480939...
Showing: 1 - 6 of 6 results