We narrowed to 6 results for: Toxoplasma gondii
-
TypeBlog Post... brains of mice chronically infected with Toxoplasma gondii." The Journal of Immunology 182.10 (2009):...and dendritic cells during infection with Toxoplasma gondii." PLoS Pathog 5.7 (2009): e1000505. PubMed...
-
27 Hot Plasmids from 2016
TypeBlog Post...apicomplexan organism Toxoplasma gondii to the infection of human fibroblasts. Toxoplasma mutants were generated...Mülleder M, et al. F1000Res. PubMed PMID: 27830062 Toxoplasma CRISPR knockout pooled library Parasites from...ten guides against each of the 8,158 predicted T. gondii protein-coding genes). Dr. Lourido’s studies demonstrate...conserved among apicomplexans and important for T. gondii fitness. Sixteen of these genes were investigated...shown to be important for the initiation of the T. gondii infection, and necessary for the asexual cycle ... -
CRISPR Plasmids - Parasites
TypeCollection...Publication Libraries Toxoplasma CRISPR Knockout Pooled Library - Toxoplasma gondii CRISPR genome-wide knockout...world. Parasites such as Plasmodium (malaria), Toxoplasma (toxoplasmosis), Trypanosoma (African sleeping... -
Microbiology Resources
TypeCollection...histolytica Leishmania sp. Plasmodium sp. Toxoplasma gondii Trypanosoma sp. Plasmids for Viruses Species... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... Ebert pSAG1::CAS9-U6::sgUPRT 54467 Other/Toxoplasma gondii none, Q5 mutagenesis yes, cut S. pyogenes ...pyogenes Sibley pU6-Universal 52694 Other/Toxoplasma gondii BsaI yes, cut S. pyogenes Lourido pRGE31 50929 Plant... -
Validated gRNA Sequences
TypeCollection...48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...cut S. pyogenes 26480473 Wolfe TGME49_290860 T. gondii ATTGGTCTGACAGCGATGTG 59855 cut S. pyogenes 25480939...