We narrowed to 3 results for: aox1

1. K. phaffii: Rising to the Occasion

   Type

   Blog Post

   ...important for methanol usage. This gene promoter, AOX1, was co-opted for the expression of recombinant ...

2. Bacterial Toxin-antitoxin Systems as Molecular Biology Tools

   Type

   Blog Post

   ... strain. MazF expression is under control of the AOX1 promoter whose expression is induced by methanol...

3. Sequencing Primers

   Type

   Guide

   ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward ...