Skip to main content

We narrowed to 9 results for: beta globin

Showing: 1 - 9 of 9 results
  1. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...Contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor. TRE General...ubiquitous. human beta actin General expression mRNA Mammalian promoter from beta actin gene Constitutive...
  2. Sequencing Primers

    Type
    Guide
    ...CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron Reverse...Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region Reverse CAT-R GCAACTGACTGAAATGCCTC...site Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT...WPRE Reverse XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin 3'UTR Reverse XEF1a TTTCGCCCTAACTTCGTGAT Xenopus...
  3. CRISPR in the Clinic

    Type
    Blog Post
    ... Transfusion-dependent beta thalassemia (TBT), both of which affect hemoglobin. Most of the targeted treatment...involved turning on fetal hemoglobin to compensate for defects in the adult hemoglobin produced (Zarghamian...
  4. Immunology Research Plasmids and Resources

    Type
    Collection
    ...inhibin, beta A EDF, FRP INHBB inhibin, beta B MGC157939 INHBC inhibin, beta C IHBC INHBE inhibin, beta E MGC4638...regulatory subunit B, beta isoform PPP3RL PRKCB protein kinase C, beta MGC41878, PKC-beta, PKCB, PRKCB1, PRKCB2...gonadotropin, beta polypeptide 7 CG-beta-a, FLJ35403, FLJ43118 CGB8 chorionic gonadotropin, beta polypeptide...Era, NR3A1 ESR2 estrogen receptor 2 (ER beta) ER-BETA, ESR-BETA, ESRB, ESTRB, Erb, NR3A2 ESRRA estrogen-related...factor, beta 1 CED, DPD1, TGFB, TGFbeta TGFB2 transforming growth factor, beta 2 MGC116892, TGF-beta2 TGFB3...catalytic, beta polypeptide DKFZp779K1237, MGC133043, PI3K, PI3KCB, PI3Kbeta, PIK3C1, p110-BETA PIK3CD phosphoinositide...
  5. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...Structure Plasmids: ER mCherry-Sec61 beta BFP-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules...CMV-LUC2CP/intron/ARE). The Luc-I intron is a chimeric β-globin/immunoglobulin intron that has been commonly used...
  6. Caltech Systemic Capsids

    Type
    Collection
    ... CN1390-rAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA minBetaGlobin SYFP2 Control Ting 163509 CN1839-rAAV-hSyn1-...recombinase iFlpV Zeng 164450 CN1851-rAAV-hI56i-minBglobin-iCre-4X2C-WPRE3-BGHpA minBG iCre expression iCre...
Showing: 1 - 9 of 9 results