We narrowed to 9 results for: beta globin

1. Multiplexed Capture of Promoter-enhancer 3D Chromatin Structures Using CRISPR

   Type

   Blog Post

   ...interactions at a promoter in the well-characterized beta globin locus. The two methods had similar rates of specificity...interactions at five sites in the well-characterized beta-globin locus were analyzed with CAPTURE 2.0, with two...

2. Plasmids 101: The Promoter Region – Let's Go!

   Type

   Blog Post

   ...Contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor. TRE General...ubiquitous. human beta actin General expression mRNA Mammalian promoter from beta actin gene Constitutive...

3. Plasmids 101: In-house NGS Plasmid Quality Control Now at Addgene

   Type

   Blog Post

   ...consisting of a CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor, contains sequence...

4. Sequencing Primers

   Type

   Guide

   ...Rabbit beta-globin intron, forward primer Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron...primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC...reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer pCasper-F...reverse primer XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin 3'UTR, reverse primer XEF1a TTTCGCCCTAACTTCGTGAT...

5. Plasmids 101: Terminators and PolyA signals

   Type

   Blog Post

   ... of AAUAAA are required for efficient rabbit beta-globin mRNA 3' end formation. Cell. 1987. PMID: 3568131...

6. CRISPR in the Clinic

   Type

   Blog Post

   ... Transfusion-dependent beta thalassemia (TBT), both of which affect hemoglobin. Most of the targeted treatment...involved turning on fetal hemoglobin to compensate for defects in the adult hemoglobin produced (Zarghamian...

7. Immunology Research Plasmids and Resources

   Type

   Collection

   ...inhibin, beta A EDF, FRP INHBB inhibin, beta B MGC157939 INHBC inhibin, beta C IHBC INHBE inhibin, beta E MGC4638...regulatory subunit B, beta isoform PPP3RL PRKCB protein kinase C, beta MGC41878, PKC-beta, PKCB, PRKCB1, PRKCB2...gonadotropin, beta polypeptide 7 CG-beta-a, FLJ35403, FLJ43118 CGB8 chorionic gonadotropin, beta polypeptide...Era, NR3A1 ESR2 estrogen receptor 2 (ER beta) ER-BETA, ESR-BETA, ESRB, ESTRB, Erb, NR3A2 ESRRA estrogen-related...factor, beta 1 CED, DPD1, TGFB, TGFbeta TGFB2 transforming growth factor, beta 2 MGC116892, TGF-beta2 TGFB3...catalytic, beta polypeptide DKFZp779K1237, MGC133043, PI3K, PI3KCB, PI3Kbeta, PIK3C1, p110-BETA PIK3CD phosphoinositide...

8. 28 Hot Plasmid Technologies from 2015

   Type

   Blog Post

   ...Structure Plasmids: ER mCherry-Sec61 beta BFP-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules...CMV-LUC2CP/intron/ARE). The Luc-I intron is a chimeric β-globin/immunoglobulin intron that has been commonly used...

9. Caltech Systemic Capsids

   Type

   Collection

   ... CN1390-rAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA minBetaGlobin SYFP2 Control Ting 163509 CN1839-rAAV-hSyn1-...recombinase iFlpV Zeng 164450 CN1851-rAAV-hI56i-minBglobin-iCre-4X2C-WPRE3-BGHpA minBG iCre expression iCre...