Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 10 of 10 results

  1. Genetic Code Expansion

    Type
    Collection
    ... Sakamoto 200225 pMega-MaPylRS PylRS M. alvus Nε-Boc-lysine Bacterial TAG Alanna Schepartz 200226 pMega-MaFRSA...

  5. Viral Production at Addgene

    Type
    Blog Post
    ...chromogenic endotoxin detection assay based on the amebocyte lysate method. Purity Purity of AAV preparations...

  6. TALEN Guide

    Type
    Collection
    ...their specificity. Two years ago, groups led by Jens Boch at the Martin-Luther-University Halle-Wittenberg...

  7. Viral Production

    Type
    Collection
    ...endotoxin assay is carried out using the Limulus Amebocyte Lysate (LAL) gel-clot method. Purity Purity of...

  10. Sequencing Primers

    Type
    Guide
    ..., reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, ...
Showing: 1 - 10 of 10 results