Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 26 of 26 results
  1. Sequencing Primers

    Type
    Guide
    ...primer M13 (-21) Forward TGTAAAACGACGGCCAGT In lacZ gene M13 (-40) GTTTTCCCAGTCACGAC In lacZ gene M13 Reverse...Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer OpIE2 Forward CGCAACGATCTGGTAAACAC (Invitrogen...Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus...GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer Full Primer ...AUG1 promoter, reverse primer BGH Reverse TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator...) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG (BD Biosciences) 5' end of EGFP, reverse...cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette, forward primer...
  2. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ... sense—CTCGAG—21bp antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense...Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: ... 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning...
  3. AAV ddPCR Titration

    Type
    Protocol
    ...probe targeting ITR: ITR Forward Primer: 5’-CGGCCTCAGTGAGCGA ITR Reverse Primer: 5’-GGAACCCCTAGTGATGGAGTT...
  4. Lentivirus ddPCR Titration

    Type
    Protocol
    ... primer: tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR...
Showing: 21 - 26 of 26 results