... harboring large inserts are often dimers in Escherichia coli K-12. Plasmid. 1989 Mar;21(2):138-41. doi...

...knows how the physical kits are made and shipped; Chiara, the tech transfer expert who understands the somewhat...

...Thermus thermophilus DNA ligase, a homolog of Escherichia coli DNA ligase." Journal of bacteriology 173.16...

... and approaches for optogenetics." Biological psychiatry 71.12 (2012): 1033-1038. PubMed PMID: 22480664...

...Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67. PMID: 30536762 Shahbazian...

...hypothalamus-habenula circuit controls aversion. Mol. Psychiatry 24(9):1351-1368. PMID:30755721 Mandelbaum G, ...

...for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product....

...of PCR products. Finney M, Nisson PE, Rashtchian A. Current Protocols in Molecular Biology. 2001...

...system for CRISPR-Cas9-assisted genome editing in Escherichia coli. Acta Biochimica et Biophysica Sinica. https...

...genome-engineering endeavours of unparalleled complexity in Escherichia coli, like the construction of a so-called “genomically...

...List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'...5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward primer 35S promoter...Forward CAATTTACATCTTTATTTATTAACG (Invitrogen) For Pichia vectors with AUG1 promoter, forward primer AUG1...Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1 promoter, reverse primer BGH ...

...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenine deaminase. Like cytosine...

...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenine deaminase. Like cytosine...