Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 8 of 8 results

  1. Transferable Skills Guide: Time Management

    Type
    Blog Post
    ...begin a task, you’re actively prioritizing. In my anecdote above, I prioritized splitting cells over meeting...the utility of your tasks. In my cell splitting anecdote, I probably could have grabbed some food with ...

  2. The Strength of Story Telling

    Type
    Blog Post
    ...Humans are designed to pay attention and enjoy anecdotal forms of information — identifying with a character...

  3. An Introduction to Adenovirus

    Type
    Blog Post
    ...measures were lifted (Servellita et al., 2023).  This anecdote goes toward saying that host-virus interactions...

  6. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...SV40 Alzheimer's Sohail Tavazoie 41848 psiCheck-ApoECDS APOE Luc SV40 Alzheimer's Sohail Tavazoie 42429...EIF2AK2 T7 VWM disease James Cole 42949 pBabePuro-ApoECDS APOE Alzheimer's Sohail Tavazoie 43908 pcDNAFLAG-ATM-kd...

  8. Sequencing Primers

    Type
    Guide
    ...Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) ...
Showing: 1 - 8 of 8 results