...proteins for imaging with this set are mTagBFP2, EGFP or one of the improved GFP variants, mRuby2 or TagRFP-T...mammalian cells, one of the improved folding variants of EGFP like mEmerald or Clover is probably best; mNeonGreen...and have reported brightness measurements. Here, EGFP outperforms the improved folding variants, presumably...

...pAAV EF1a Nuc-flox(mCherry)-EGFP Brandon Harvey 50457 AAV2 pAAV-hSyn-DIO-EGFP Bryan Roth 50459 AAV1 pAAV-hSyn-DIO-mCherry...pAAV-hSyn-DIO-mCherry Bryan Roth 50457 AAV1 pAAV-hSyn-DIO-EGFP Bryan Roth 114472 AAVrg pAAV-hSyn-mCherry Karl...

...receptor (EGFR) with the ClonTracer library and monitored population dynamics after treatment with EGFR inhibitor... in a study focusing on tumor cell resistance to EGFR inhibitor (Hata et al., 2016).  Bhang deposited ...

...halves of EGFP to recombine by homology directed repair, and resulting in the expression of EGFP. Using ...indicates where your target is inserted, disrupting the EGFP fluorescent signal, for details on this plasmid,...

...(Plasmid 116771: pHAGE-PIK3CA) and EGFR (Plasmid 116731: pHAGE-EGFR), are represented in this collection...

.... Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin...destination vector expressing a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase...et al 2015). He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison...be conveniently performed through the N-terminal eGFP tag carried on all constructs.   pXPG: An alternative...

...real-time. The reporter constitutively expresses eGFP to indicate reporter abundance, and mCherry fluorescence...involves tracking the ratio of mCherry-positive to eGFP positive cells through fluorescence microscopy or...

...caused by T cell migration.  CAR expression (or the eGFP proxy for CAR) is elevated at stable levels for ...      Fig. 2: Addgene’s western blot for mEGFP-HRas (from Plasmid 18662). See the Applications ...

... including those targeting EGFP, BRAF, and MAP3K4. The gRNAs targeting EGFP can be used as positive controls...

...sequence in between two fragments of EGFP in pCAG-EGxxFP. The EGFP fragments contain 482bp of overlapping...their 3 Opto-RTK constructs – Opto-mFGFR1, Opto-hEGFR, and Opto-hRET – as well as various LOV-domain-mVenus...

...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...

...nucleotides, such as the fluorescent proteins EGFP and mEGFP. Many of these features, such as Cas9, weren...

...This set of new anti-FLAG frankebodies includes mEGFP, mRuby2, iRFP713, SNAP-tag, and HaloTag fusions,...fusions, while the anti-HA frankenbodies include mEGFP, mCherry, and HaloTag. Figure 1: (a) Anti-FLAG...

...detect weak dimerization tendency, as is present in EGFP. Constantini et al, (2012) developed a cell-based... properties of new fusions can be compared with mEGFP or mTurquoise2, which are established true monomeric...

...targeted synaptophysin tagged eGFP. AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE from Hongkui Zeng's lab...

...repair by non-homologous end joining (NHEJ) or HDR. EGFP validation of sgRNAs: Can evaluate component delivery...efficacy by cloning in genome target sequence into EGFP reporter. Target DNA reporter system: Can evaluate...

...pMAK463 (NBαMouse-IgK, Addgene #140701) pMAK464 (NBαEGFP, Addgene #140702) The pMAK461-64 plasmids were...introduced into the hPSC genome using AAV1 and contain an EGFP reporter. Expression of the dCas9-KRAB activator...

...for miRFPnanos, 35 kDa for miRFPs, and 27 kDa for EGFP) and a possibility to be used as internal tags due... normalization to fluorescence of co-transfected EGFP. e Originally reported as a monomer16, IFP2.0 was...

...et al 2015). He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison...be conveniently performed through the N-terminal eGFP tag carried on all constructs. The Cell-Free Protein...

... and sequence overlap (coral mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully... is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2 as the fluorophores; mOrange2 is the ...