...The most requested ubiquitin plasmids were pRK5-HA-Ubiquitin-WT and HA-Ubiquitin, and we now have 19 different...requested. Ubiquitin - One particular gene we saw increased interest in from 2008 to 2009 was ubiquitin. The...different ubiquitin plasmids in the repository. 100,000 Plasmids Shipped! - By 2010, Addgene had hit our...founded 10 years ago today. In that time, Addgene has shipped over 350,000 individual plasmids to 5,000...5,000 different research institutions. This has given us a unique window into technology trends in the life...the CRISPR." The newest genome editing technology has been used and modified by so many labs and for so...

...protein-of-interest and the CRBN E3 ligase complex leading to ubiquitination and proteasomal degradation. Adapted from Nabet...interacting ligands. After an E3 ligase facilitates ubiquitination of the Halo-tagged protein in question, it ...endogenously expressed SCF complex members, an E3 ubiquitin ligase complex. Finally, when auxin is added in...TIR1 F-box associated E3 ligase complex will ubiquitinate the AID-tagged protein which will target it ...In the last decade, the use of degron tags has become increasingly popular for the modulation of endogenously...protein levels can return to normal once the drug has been removed. The degradation and reversal are rapid... its first use as a protein regulation tool, AID has gone through an additional round of evolution (AID...

...In plants, auxin binds to TIR1 of the SCF-TIR1 ubiquitin ligase complex, promoting its interaction with...have this response, they do contain the specific ubiquitin ligase pathway needed for AID. By tagging proteins...cells, which interacts with the cells’ endogenous ubiquitin ligase, the Kanemaki lab was able to translate...proteins (Natsume et al., 2016). Now, the Kanemaki lab has created a new toolkit of plasmids for the N- or C...

...epitope (GKPIPNPLLGLDST) has been used as a tag since 1992 (Hanke et al., 1992), and has proven itself a versatile...By Mike Lacy Several types of drugs target the ubiquitin E3 ligase cereblon (CRBN), including popular new...with the multiple myeloma drug mezigdomide and ubiquitination substrate Ikaros (IKZF1ZF2) (B). Image adapted...structure-guided drug design and studies of protein ubiquitination and degradation.   Find the CRBNmidi plasmid...like PROTAC targeted protein degraders. But CRBN has been difficult to study in vitro, requiring either...Cas9 system By Aryana Khosravani Deborah Hung’s lab has developed a novel dual-plasmid CRISPR/Cas9 system...

...an E3 ubiquitin ligase, is the basis of TRIM-away. In normal physiology, TRIM21 recruits ubiquitin and ...the Fire-Cas9 Podcast Segment Jerry Crabtree’s lab has developed a new CRISPR/Cas9-based system to study.... While catalytically inactive cas9 (e.g. dCas9) has been fused to a variety of protein modules to repress...synthetic transcription factors, the El-Samad lab has deposited plasmids encoding fluorescent reporters...

...endogenous Skp1 and Cul3 proteins to form a SCF E3 ubiquitin ligase complex. In the presence of auxin, this...developed a chemogenetic system that brings Cas9 to ubiquitin ligase for degradation.      New from the viral...Cecchetelli The auxin inducible degron (AID) system has been extensively used in C. elegans since 2015 to...light-inducible CRISPR system developed by Taekjip Ha’s lab where Cas9-gRNA complex binds the target DNA...

... and VSV-G. This plasmid has been used in studies of the secretome, ubiquitin ligase, cellular senescence...! Lentivirus envelope vector pMD2.G This plasmid has been requested nearly 6,000 times (over 800 orders...

...expression mRNA Mammalian promoter from the human ubiquitin C gene Constitutive  As the name implies, this...General expression mRNA Plant promoter from maize ubiquitin gene Constitutive  Gives high expression in plants...transcript, you will also need to make sure your plasmid has a promoter suited to working in your host organism... but requires SP6 RNA polymerase. SP6 polymerase has a high processivity. When used for in vitro transcription...

...tag c-Flag pcDNA3 or FLAG-HA-pcDNA3.1 - C-terminal Flag or N-terminal FLAG-HA for mammalian expression ...systems, including Xenopus HA Epitope tag pcDNA3.1-HA or c-Flag pcDNA3 - Mammalian expression...expression vector with N- or C-terminal HA tag pInducer20 - Tet-inducible HA-tagged lentiviral vector for ORF...gene with cap-dependent 3Myc-EYFP-HA-His6 and IRES-dependent ECFP-HA-His6 translation for mammalian expression...Expression collection page Plant CaMV35S, RPS5A, Ubiquitin pYPQ203 (pMDC32-Ubi1) - Multisite Gateway T-DNA...with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated transformation... your protein to an epitope tag, such as Flag or HA, will allow you to easily identify your protein...

...which a good antibody has not been developed (and just because your protein has a commercially available...crystallizing it or testing its function. Small ubiquitin-related modifier (SUMO) can help with folding ...localization, or protease protection. Thus far Plasmids 101 has covered GFP and its related fluorescent proteins,...affinity tag to it. The FLAG, hemaglutinin antigen (HA), and c-myc tags have been the workhorses of the ...Purification Good for antibody-based purification; has inherent enterokinase cleavage site GST Large Protein...against proteolysis, but may reduce solubililty HA YPYDVPDYA or YAYDVPDYA or YDVPDYASL  1.1 Affinity... a moment), and 2 ProtA IgG-binding domains. TAP has since come to encompass several other tag combinations...

...wanted to find a lentiviral plasmid to express ubiquitin under control of a CMV promoter. Starting with...useful in an experiment, and want to see if someone has already created and deposited it with Addgene. Combining...resistance gene(s) used for selection in bacteria. Has Viral Service?: Allows you to filter results to only...

...requirement for transmembrane proteins, a split ubiquitin system has been devised (8). References 1. Casadaban...cells where binding between the proteins of interest has occurred. Although the original Y2H systems utilized... number of different bait and prey vectors. This has been shown to be as effective as using five independent...

...labelled with a AAV8 expressing eGFP under the human ubiquitin C promoter. Anatomical abbreviations: Gr= Gracile...University of Miami. The beginning of this century has seen some major advances in light microscopy, particularly...unprecedented detail.  One of these advances in microscopy has been light sheet fluorescence microscopy (LSFM). ...

...ligand binding assays, phage display assays, ubiquitination activity assays, toxin activity, small molecule...instances where it does. 1) When the backbone vector has multiple BbvCI sites. If these sites have opposite...example like this. 2) When your gene of interest has a BbvCI site(s). If so, the nicking mutagenesis protocol...

...sites changes to UAG, RF1 function removed, with Ubiquitin-UAG-sfGFP reporter George Church 98565 C321.ΔClpS.Ub-UAG-sfGFP... RF1 function removed, ClpS inactivated, with Ubiquitin-UAG-sfGFP reporter George Church 174513 Syn61 ...its cognate aminoacyl-tRNA-synthetase (aaRS) that has been evolved to incorporate non-canonical amino acids...aminoacylate the orthogonal tRNA. And the orthogonal tRNA has to bind to an unallocated codon. Therefore many controls....1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA synthetase...

...YFP. After crossing onto a tamoxifen-inducible ubiquitin background, each cell in the mouse that expresses...track single cell dynamics at the organism level has been made possible by tools that allow cells to become... such as neurons in the fly visual system, which has been difficult to study previously (Hadjieconomou...of cells in the intestinal crypt, and since then has become a powerful tool for understanding cell proliferation...

...cauliflower mosaic virus 35S promoter (CaMV 35S) or ubiquitin promoters (Belhaj et al., 2013). Addgene carries...last updated Dec 22, 2020 by Benoit Giquel. CRISPR has taken the genome engineering world by storm owing...that regulate a desired phenotype. In fact, CRISPR has already been used to engineer the genome of many ...to protoplast cells (plant cells whose cell wall has been removed). Another common delivery method is ...developed for plants and prime editing for plants has been developed for rice by Yiping Qi’s lab and for...

...phosphorylation, acetylation, methylation and ubiquitination. For example, to test if a protein is phosphorylated...top of the resolving gel. A stacking gel typically has a different ionic strength and lower pH and acrylamide...Choosing your primary antibody Once the membrane has been blocked, it is stained with a primary antibody...the vendor’s website and choose an antibody that has been validated for immunoblotting. Different immunoassays..., cytoplasm and nucleus.  We hope that this blog has provided you with a good overview of the western ...

...chemokines; enzymes like kinases, phosphatases, and ubiquitin ligases; and many more. This process, however,...selecting the primary antibody host species, as it has to be different from the other antibodies in your...

...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse...forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT...primer you need? Email us at [email protected] Addgene has used a number of primers for sanger sequence verification...