Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 8 of 8 results
  1. Plasmids 101: Inducible Promoters

    Type
    Blog Post
    ...exposure. Examples include the heat shock-inducible Hsp70 or Hsp90-derived promoters, in which a gene of choice... exposure to a brief heat shock. In the case of Hsp70, the heat shock releases heat shock factor 1 (HSF...
  2. Of Myc and Men

    Type
    Blog Post
    ...2075.1984.tb02263.x  Munro S, Pelham HRB (1986) An hsp70-like protein in the ER: Identity with the 78 kd ...
  3. FlyCRISPR

    Type
    Collection
    ...46294 pBS-Hsp70-Cas9 : A codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter...45945 pHsp70-Cas9 : The codon-optimized Cas9 nuclease under the control of the Drosophila hsp70 promoter...genome alterations can be generated within a month. phsp70-Cas9 and a single chiRNA plasmid can be coinjected...mutations via imperfectly repaired DSBs. Coinjection of phsp70-Cas9 and plasmids encoding two chiRNAs can induce...
  4. Cre-lox system

    Type
    Collection
    ...30524 pCSHSP:Cre heat shock inducible Cre Xenopus hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI...tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus Ryffel 31132 pCSCre Cre CMV Xenopus Ryffel 31309... recombinases that are less toxic in Drosophila hsp70 Insect Rubin 32606 Ttr:Cre Cre expressed in visceral...control Gal1 Yeast Gartenberg 50797 pUAS-Cre Cre UAS/Hsp70 Mammalian Cepko 50935 MSCV-PIG-Cre Cre and GFP coexpression...alpha Lentiviral Jacks 60877 pMAZe Cre and dtomato hsp70 Zebrafish Lewis 60930 pPL5071_TEF1*-Cre_URA3 Cre...See article for more colors. Mammalian Zeng 24334 hsp70l-loxP-mCherry-STOP-loxP-H2B-GFP_cryaa-cerulean Heat-inducible...
  5. Sequencing Primers

    Type
    Guide
    ...primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT...
  6. Immunology Research Plasmids and Resources

    Type
    Collection
    ...FLJ54328, HSP70-1B, HSP70-2, HSPA1A HSPA1L heat shock 70kDa protein 1-like HSP70-1L, HSP70-HOM, HSP70T, hum70t...protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, RY, hsp70, hsp70RY...FLJ54370, FLJ54392, FLJ54408, FLJ75127, HSP70-1, HSP70-1A, HSP70I, HSP72, HSPA1, HSPA1B HSPA1B heat shock..., GRP78, MIF2 HSPA6 heat shock 70kDa protein 6 (HSP70B') - HSPA8 heat shock 70kDa protein 8 HSC54, HSC70...
Showing: 1 - 8 of 8 results