Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 6 results for: hsp70

Clear keywords
Showing: 1 - 6 of 6 results

  1. Plasmids 101: Inducible Promoters

    Type
    Blog Post
    ...exposure. Examples include the heat shock-inducible Hsp70 or Hsp90-derived promoters, in which a gene of choice... exposure to a brief heat shock. In the case of Hsp70, the heat shock releases heat shock factor 1 (HSF...

  2. Of Myc and Men

    Type
    Blog Post
    ...2075.1984.tb02263.x  Munro S, Pelham HRB (1986) An hsp70-like protein in the ER: Identity with the 78 kd ...

  3. Sequencing Primers

    Type
    Guide
    ...Reverse pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter Forward pcDL-F GTTGCCTTTACTTCTAGGCCT 5'...

  4. Immunology Research Plasmids and Resources

    Type
    Collection
    ...FLJ54328, HSP70-1B, HSP70-2, HSPA1A HSPA1L heat shock 70kDa protein 1-like HSP70-1L, HSP70-HOM, HSP70T, hum70t...protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, RY, hsp70, hsp70RY...FLJ54370, FLJ54392, FLJ54408, FLJ75127, HSP70-1, HSP70-1A, HSP70I, HSP72, HSPA1, HSPA1B HSPA1B heat shock..., GRP78, MIF2 HSPA6 heat shock 70kDa protein 6 (HSP70B') - HSPA8 heat shock 70kDa protein 8 HSC54, HSC70...

  5. CRISPR References and Information

    Type
    Collection
    ...and cloning; injection protocol pU6-BbsI-chiRNA ; phsp70-Cas9 PDF, 109 KB Orkin and Bauer Protocol for Genomic...
Showing: 1 - 6 of 6 results