... pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter... pU6-sgGAL4-4 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter...repurposed the bacterial immune system, CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R...pdCas9-bacteria A catalytically inactive bacterial Cas9 expression plasmid 44250 pwtCas9-bacteria A wild-type...Two-plasmid CRISPRi system for bacterial gene knockdown The first plasmid ( pdCas9_bacteria ) contains an anhydrotetracycline...expression plasmid for use editing bacterial genomes 44251 pgRNA-bacteria A customizable gRNA expression ...platform, to repress expression of arbitrary genes in bacteria or human cells ( Qi et al. ). This CRISPR interfering...

...based on p-element, random or targeted, integration into the fly genome and are under the Gal4 inducible... to insert YGOI, a bacterial selection cassette for growth and cloning in bacteria and a mammalian selection...accessory packaging vectors to generate the virus. Bacterial vectors This system is great for overexpressing...isolated, controlled environment. In most cases bacterial expression vectors are inducible (e.g. pBAD LIC...

...fruit fly is the array of genetic tools, such as the GAL4/UAS and LexA system, that allows scientists to easily...systems but can be quite difficult and time consuming. GAL4/UAS was first described in 1993 by Norbert Perrimon...PubMed Central PMCID: PMC5349099. Nguyen, Jeffrey P., et al. "Whole-brain calcium imaging with cellular...cancer since mice better recapitulate the complex interactions between cancer cells, therapeutic drugs, and...mice to study how different mutations in leukemia impact different treatment regimens (Zuber et al., 2009... model organisms is that they are genetically tractable. Mice can be easily manipulated with tools like...not only for the reasons above but because they actually share many biological properties and processes...

...original Y2H systems utilized the yeast Gal4 activator, bacterial LexA DBD and the lacZ reporter gene (3...Chen, Y.C., Rajagopala S.V., Stellberger T., Uetz P.  Exhaustive Benchmarking of the yeast two-hybrid ...668. Pubmed PMID: 20805792. 7. Stynen B., Van Dijck P., Tournu H. A CUG codon adapted two-hybrid system ...20719741. Pubmed Central PMCID: PMC2965261. 8. Obrdlik, P., El-Bakkoury, M., Hamacher, T., Cappellaro, C., Vilarino...molecular interactions in the cell, including protein-protein, protein-DNA and protein-RNA interactions. The...transcriptional activators: that the DNA binding domain (DBD) and transcriptional activation (TA) domains...GFP), regardless of whether it interacts with a transcriptional activator (1a) or a repressor (1b). Scientists...

...or localization experiments Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ...Modified pUAST vector containing both P-elements and attB site for high expression...Independent Cloning (LIC) Bacteria Lac, T7, araBAD p15TV-L - His-tagged bacterial expression vector...Flag for bacterial expression pET Flag TEV - N-terminal Flag-TEV for bacterial expression...TEV tag for bacterial expression pET His6 - C-terminal His6 tag for bacterial expression...Arrowsmith Lab Plasmids - More LIC bacterial cloning vectors pTD plasmid ... lab collection for more) pLexA and pACT2.2 - Yeast 2-hybrid plasmids Fly UAS...

... primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain, forward primer Gal4-AD AATACCACTACAATGGAT...AATACCACTACAATGGAT (BD Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC... in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element, reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG...Drosophila Actin 5C promoter, forward primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal...forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward...primer F1ori-F GTGGACTCTTGTTCCAAACTGG F1 origin, forward primer GAL1 AATATACCTCTATACTTTAACGTC (Invitrogen...-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT (Kinet...

... pM-ErbB4CTF ERBB4 GAL4-BD ALS Marius Sudol 17798 pM-ErbB4CTF-PY1 mutant ERBB4 GAL4-BD ALS Marius Sudol...pM-ErbB4CTF-PY3 mutant ERBB4 GAL4-BD ALS Marius Sudol 17800 pM-ErbB4-delta-kinase ERBB4 GAL4-BD ALS Marius Sudol... mutant ERBB4 GAL4-BD ALS Marius Sudol 17802 pM-ErbB4-delta-kinase-PY3 mutant ERBB4 GAL4-BD ALS Marius... 214613 pcDNA3_ERBB4-NTEV-tcs-GV-2xHA ERBB4 TEV, Gal4, VP16, HA CMV ALS Michael Wehr 214672 lucMAPT-30D... 74170 pVEX-CC1 DCTN1 tac ALS Trina Schroer 75437 p-AAV-sh[SNCA] SNCA U6 Parkinson's Edward Burton 75637...TARDBP His, GST, Factor Xa cspA ALS Aaron Gitler 27452 pCold TDP43 G294A TARDBP His, Factor Xa cspA ALS Aaron...M337V TARDBP His, Factor Xa cspA ALS Aaron Gitler 27454 pCold TDP43 Q331K TARDBP His, Factor Xa cspA ALS Aaron...