Skip to main content
Addgene
Showing: 1 - 20 of 21 results

  1. Plasmids 101: Protein Expression

    Type
    Blog Post
    ...pharmaceuticals, specifically interleukins. Yeast expression systems Yeast are a great expression system to generate...proteins under the control of the galactose inducible promoter (GAL). Other commonly used promoters include...These include mammalian, insect, bacterial, plant, yeast and cell free expression systems. Overall the general...proteins that cannot be produced in  E. coli or yeast cells. The only problem with baculovirus systems...recombinant eukaryotic proteins. Although many species of yeast can be used for protein expression, S. cerevisiae...inducible PHO5 and CUP1 promoters respectively. Yeast cells are grown in well-defined media and can be...large-scale, stable production of proteins. In general yeast expression systems are easier and cheaper to work...

  2. Pathways Over Time Plasmids Engage Students in Functional Genomics Research

    Type
    Blog Post
    ...genes (Figure 1) from the two yeast species into the pYES2.1/V5-His yeast overexpression vector. This plasmid...Addgene.org Find Yeast Expression Vectors Check Out Our Molecular Biology Reference Pages Learn Simple Lab...gene in the reference species. We have been using yeast models (3, 4) to answer questions about the evolution...involved in methionine synthesis (5). The budding yeast, Saccharomyces. cerevisiae, makes a great reference...students test whether or not proteins from the fission yeast, Schizosaccharomyces pombe, have the same function...as their counterparts in S. cerevisiae. The two yeasts are thought to have diverged from a common ancestor...presence of the URA3 gene allows students to select yeast that have been successfully transformed with the...

  3. Five Popular Model Organisms

    Type
    Blog Post
    ...the fly (Pfeiffer et al., 2010). Yeast (Saccharomyces cerevisiae) Yeast, one of the simplest eukaryotic.... Like human cells, yeast DNA is packaged into chromosomes and about 23% of yeast genes have a counterpart...homolog involved in yeast cell division (Pray, 2008). Scientific discoveries in yeast can then can be further...same kind we use in breads and other baked goods! Yeast is cheap, simple and easy to work with as they can...environmental conditions, and double every 2 hours. Yeast are also the first eukaryotic genome to be entirely...sequenced and is very amenable to genetic manipulation. Yeast cells are great model organism not only for the ...counterpart in humans (Liu et al., 2017) . Thus yeast can be used to study the molecular basis of human diseases...

  4. Plasmids 101: Repressible Promoters

    Type
    Blog Post
    ...ethanol consumption phase of yeast culture. Repressible Binary Systems GAL4/UAS In Drosophila or development... One common binary system is the GAL4/UAS system isolated from yeast. In this system, UAS basal promoter...negative repressible promoter is commonly used in yeast. In the first 24 hours of culture, when glucose ... promoter activity (~20% activity of the strong yeast promoter pTEF). As ethanol accumulates, it binds...applications in Saccharomyces cerevisiae.” FEMS Yeast Res. 12(2) (2012): 197-214. PubMed PMID: 22129153... system). The GAL80 repressor can bind to GAL4, partially inhibiting the binding of GAL4 to UAS. One can...domain (DBD) to GAL4 or VP16 activation domain results in chimeric GAL80-repressible and GAL80-insensitive...

  5. Quickest Way to Deposit Plasmids: The Deposit Spreadsheet

    Type
    Blog Post
    ...(nematode), S. cerevisiae (budding yeast), S. pombe (fission yeast), A. thaliana (mustard weed), O. cuniculus...lentiviral, retroviral, AAV, RNAi, luciferase, cre/lox, yeast expression, worm expression, insect expression, ... Addgene home page, if you scroll over “Deposit” in the mega menu at the top of the page, you’ll see two...), M. musculus (mouse), R. norvegicus (rat), G. gallus (chicken), B. taurus (bovine), X. laevis (frog)...Please indicate which growth strain Addgene should propagate your plasmids in: DH5α, NEB Stable, ccdB Survival...Survival, Pir1, or other. Whenever possible, we propagate plasmids in the standard cloning strain DH5α. For...choose the Pir1 strain. If your plasmid cannot be propagated in any of these standard strains, choose other...

  6. Qi Lab CRISPR Page

    Type
    Collection
    ...targeting endogenous CXCR4 gene 46920 pTDH3-dCas9 Yeast CEN/ARS vector (Leu2) that contains dCas9 fused ...controlled by TDH3 promoter 46921 pTDH3-dCas9-Mxi1 Yeast CEN/ARS vector (Leu2) that contains dCas9 fused ...integrated into HEK293 genome 46922 pSNR52-sgTEF1 Yeast CEN/ARS vector (Ura3) that contains sgRNA controlled...targeting endogenous TEF1 promoter 46923 pSNR52-sgTET Yeast CEN/ARS vector (Ura3) that contains sgRNA controlled... pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter... pU6-sgGAL4-4 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter...

  7. Synthesized by Ginkgo Bioworks, Shared by Addgene: SARS-CoV-2 Plasmids for Many Expression Systems

    Type
    Blog Post
    ...expressed in non-mammalian cells. Yeast expression plasmids The yeast expression constructs contain protein... form and we’ll add your citation to the plasmid page on our website. Contributing your results helps ...available plasmids listed on Ginkgo’s collection page.  Bacterial expression plasmids For those constructs...backbones which drive expression using either TEF1 or GAL1 promoters. These vectors are intended for the high... time. Visit our COVID-19 Plasmids and Resources Page! References Fukushi S, Watanabe R, Taguchi F (...

  8. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...protein‐tracking studies in the budding yeast Saccharomyces cerevisiae." Yeast 25.9 (2008): 651-659. PubMed PMID...applications PA-FPs have been developed for use in yeast, as parts of biosenors, and much more. Do you have... tagged to a mitochondrial matrix protein (mito-PAGFP) the Youle Lab was able to visualize and quantify...16980368. PubMed Central PMCID:PMC1635685. 12.Paez-Segala, Maria G., et al. "Fixation-resistant photoactivatable...

  9. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...TARDBP GAL ALS Aaron Gitler 27465 pDuet TDP-43 Q331K TARDBP GAL ALS Aaron Gitler 27466 pRS426 Gal TDP43...TDP43 TARDBP GAL ALS Aaron Gitler 27467 pRS426 Gal TDP43 GFP TARDBP GFP GAL ALS Aaron Gitler 27468 pRS303... pAG303-Gal-PR50 C9orf72 FLAG, Myc GAL1 ALS Aaron Gitler 84906 pAG303-Gal-PA50 C9orf72 FLAG, Myc GAL1 ...84907 pAG303-Gal-GA50 C9orf72 FLAG, Myc GAL1 ALS Aaron Gitler 84908 pAG303-Gal-GR100 C9orf72 GAL1 ALS Aaron...181709 pAG416-GAL-TDP-43 TARDBP GAL1 ALS Alejandro Chavez 181710 pAG416-GAL-hnRNPA1 HNRNPA1 GAL1 ALS Alejandro...Chavez 181711 pAG416-GAL-FUS FUS GAL1 ALS Alejandro Chavez 181716 pAG416-GAL-FUS-G156E FUS GAL1 ALS Alejandro...181717 pAG416-GAL-FUS-P431L FUS GAL1 ALS Alejandro Chavez 181718 pAG416-GAL-FUS-R521C FUS GAL1 ALS Alejandro...

  10. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... expression URA3 Yeast pXP518 - Yeast expression vector pPS808 - Yeast expression ...) TRP1 Yeast pXP216 - Yeast expression vector (PGK1 promoter, 2μ) pXP316 - Yeast expression...LEU2 Yeast pXP122 - Yeast expression vector (PGK1 promoter, CEN/ARS) pXP222 - Yeast expression...vectors) HIS3 Yeast pXP220 - Yeast expression vector (PGK1 promoter, 2μ) pAG303GAL-ccdB - Yeast...Set of yeast expression vectors with various markers, promoters, etc pRS420 - Yeast expression...purification or localization experiments Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ... Xenopus pAG423GPD-ccdB-HA - C-terminal 3xHA tag for yeast expression Myc Epitope...

  11. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    .... These are less well known fungi (they are not yeast or mushrooms) but there are over 1,000 species. ...experimental species. Discovering ways to culture, propagate, transform, store, and share all of these new ...next project. Gymnotiformes and Mormyridae (Jason Gallant) Weakly electric fish are excellent systems to ...cephalopods die after they lay their 1 clutch of eggs? Propagation is thus quite difficult. CRISPR genome editing...

  12. Getting the Most from Your Lentiviral Transduction

    Type
    Blog Post
    ... unlike infections with larger microbes such as yeast, fungi, or bacteria, mycoplasma can be extremely...Seye, A.K., Majdoul, S., Martin, S., Merten, O.W., Galy, A., Fenard, D. ”Influence of mildly acidic pH conditions...All Things Lentivirus with our Lentiviral Guide Pages Deposit Your Lentiviral Vectors ...

  13. Cre-lox system

    Type
    Collection
    ...optimized for yeast Gal1 Yeast Sandmeyer 26853 pBF3060 Cre codon optimized for yeast Gal1 Yeast Sandmeyer ...mutant TEF2 Yeast Piper 60931 pPL5608_TEF1*-Cre_TRP1 Cre expressed at low levels mutant TEF1 Yeast Piper 60932...mutant TEF1 Yeast Piper 60933 pPL5628_TEF1*-Cre_MET15 Cre expressed at low levels mutant TEF3 Yeast Piper 61391...TDH3 Yeast van Leeuwen 64770 pSS146 Cre fused to the human Estrogen Binding Domain (EBD) Tdh4 Yeast van...pSH62-EBD Cre-EBD - Estradiol-dependent control Gal1 Yeast Gartenberg 50797 pUAS-Cre Cre UAS/Hsp70 Mammalian...recombinase CAG AAV Bruchas 78398 pNXRVa-HACre Cre CMV Yeast Tomita 82587 pME-ERT2-Cre-ERT2 Tamoxifen-inducible...Capecchi 137862 pCAGGS-mTagBFP2-T2A-iCreERT2 (PAGSA) iCre-ERT2 (PAGSA N-terminus) - Tamoxifen inducible CAG Mammalian...

  14. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Basta Kim pMZ283 52224 Yeast CspCI none S. pyogenes URA4 Zaratiegui pJZC588 62315 Yeast none S. pyogenes URA3...gRNA_handle_RPR1t 62966 Yeast HindIII none S. pyogenes Puro Lu pML104 67638 Yeast BclI-SwaI yes, cut S. ...Wyrick pML107 67639 Yeast BclI-SwaI yes, cut S. pyogenes LEU2 Wyrick pT040 67640 Yeast BclI-SwaI none S....Jackson pMZ376 74213 Yeast rrk1 yes, cut S. pyogenes KanMX Zaratiegui pMZ377 74214 Yeast rrk1 yes, cut S. ...enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9 79903 Yeast RPR1(TetO) yes, cut S. pyogenes URA3 Davis... Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide ...Mammalian, Lentiviral, AAV, Bacteria, Drosophila, Yeast, Plant, Xenopus, Worm, or Other. Whether the plasmid...

  15. With an Eye Towards the Future, We Look Back at the March for Science

    Type
    Blog Post
    ...Vancouver, BC (Canada). She works in a lab that uses yeast cells to study how DNA damage promotes cancer. She... before.  These attacks on science ultimately galvanized scientists to rally in Ottawa to protest the ...research is vital in combating misinformation and propaganda that limits access to full reproductive health...AL, USA 33.5207°N 86.8025°W - Jonathan Aguilar Galileo wrote, “now you would not hide behind these two... large one” (http://oll.libertyfund.org/titles/galilei-dialogues-concerning-two-new-sciences). This is...

  16. Sequencing Primers

    Type
    Guide
    ...primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT...origin, forward primer GAL1 AATATACCTCTATACTTTAACGTC (Invitrogen) S. cerevisiae GAL1 promoter, forward primer...primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain, forward primer Gal4-AD AATACCACTACAATGGAT (BD Biosciences...useful in your sequencing reaction, find your plasmid page and see what primers are listed under "5' sequencing...please consult Addgene's Molecular Biology Reference Page . All listed primers are 5′ to 3′. Commonly Used...Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP...

  17. Molecular Biology Reference

    Type
    Guide
    ...drive expression in various cell types (mammalian, yeast, bacterial, etc.), depending largely on which promoter...England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC...viral service page to learn more. Regardless of type, plasmids are generally propagated, selected for,...Delta-lacX74 recA1 araDelta139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen...(TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15 e14- Φ80dlacZ∆M15 recA1 relA1 endA1 nupG rpsL...Delta-lacX74 recA1 araD139 Delta(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG Antibiotics commonly used...Introduction Types of Plasmids E. coli strains for propagating plasmids Antibiotics commonly used for plasmid...

  18. TALEN Plasmids and Kits

    Type
    Collection
    ...TALORs (TAL Orthongal Repressors) that can be used to custom repress gene expression in yeast. TALORs consist...-BB contains the GAL1 promoter, placing TALORs built into this vector under galactose-inducible expression...Mendenhall The TALE plasmid vectors described on this page are designed to target and edit the epigenome of...

  19. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...an improved peroxidase reporter, APEX2, through yeast display. APEX2 has been shown to exhibit superior... see our CRISPR/Cas Plasmids: Pooled Libraries webpage or read our blog post,Lentiviral CRISPR Libraries...Chronos & Chrimson Through de novo sequencing of 127 algal transcriptomes, as well as further optimization ...more information, please see Addgene’s information page for the Rinehart phosphoprotein system, which includes...plasmids updates frequently, so visit our CRISPR pages often to find the most recently deposited tools,...GreenGate cloning system, see the detailed plasmid kit page or read our blog post: Quick, Versatile Plant Transgenesis...

  20. CRISPR Guide

    Type
    Guide
    ...libraries are also available, such as those for yeast or drosophila . Although CRISPR has been less widely...SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology , 36 (3), 265–271. PMID: 29431739...plasmids and resources at Addgene Blog CRISPR topic page How to design your gRNA for CRISPR genome editing... Gainetdinov, I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer... Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman...
Showing: 1 - 20 of 21 results