...The post is in memoriam of his late father and pBABE’s namesake, Harold (Babe) Morgenstern. Dr. Morgenstern...story of his incredibly popular retroviral vector pBABE-puro. Read on to learn more about the fascinating...father, Harold (Babe) Morgenstern. The origins of pBABE Well, it was way back in the mid 1980s and Dr. Hartmut...selection) we had to name them. In honor of a father, pBABE gets its name It so happened that the genesis of... after him.  The rest, as they say, is history: pBabe vectors have been used in innumerable studies and... pbabe...

... PI 1764 pBABE-puro MoMLV For transgene expression; Puromycin selection; For additional pBabe plasmids...plasmid page and search for ‘pBabe’ Land , Morgenstern , Weinberg 1780 pBABE-neo largeTcDNA MoMLV Expression... Lab page for resistance variants Weinberg 1773 pBABE-hygro-hTERT MoMLV Expression of hTERT for creation...

...pSG5L Flag HA - Transient expression pBABE-puro - Retroviral expression pWPXL... Backbones Neomycin (G418) Mammalian pBABE-neo - Retroviral gene expression ...gene expression Puromycin Mammalian pBABE-puro - Retroviral gene expression... expression Hygromycin Mammalian pBABE-hygro - Retroviral gene expression...expression (tet inducible) Zeocin/Bleo Mammalian pBABE-zeo - Retroviral gene expression ...vector for gene expression GFP Varies pBABE GFP - Retroviral gene expression ... plasmid page . Retroviral Easy and safe to use pBabe plasmids - Mammalian retroviral...

...Transfer Vectors   Expressing your gene of interest pBABE-puro (Plasmid #1764) Retroviral vector for cloning...puromycin selection. One of the scientists who created pBabe writes how its name came about here. Cloning and...

...a negative control, and empty backbones such as pBABE-puro for retroviral expression and pLVTHM, a lentiviral...

...forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, ...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse...reverse primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, ...

... Bjorkman 11503 pBabe neo human Frataxin FXN Friedreich ataxia Ronald Kahn 11504 pBabe hygro human Frataxin...Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan Massague 58260 pBabe-Neuroserpin oloop SERPINI1...Massague 58261 pBabe-FLAG-Neuroserpin SERPINI1 Flag Dementia Joan Massague 58262 pBabe-Puro-FLAG-Neuroserpin...Huda Zoghbi 92203 pBABE-delta-Syn-nYFP SNCA YFP CMV Parkinson's Huda Zoghbi 92204 pBABE-Tau-nYFP MAPT YFP...shSOD1mismatch SOD1 H1 ALS Patrick Aebischer 11442 pBabe bleo human Frataxin FXN Friedreich ataxia Ronald...Frataxin FXN Friedreich ataxia Ronald Kahn 11505 pBabe puro human Frataxin FXN Friedreich ataxia Ronald...CFP-Parkin PRKN CFP CMV Parkinson's Richard Youle 48685 pBabe(puro)-Omi-mCherry HTRA2 mCherry LTR Parkinson's ...

... Type MSCV-IRES-EGFP IRES Retroviral pMSCV-pBabeMCS-IRES-RFP IRES Retroviral pMSCV-IRES-YFP II IRES...