Skip to main content

We narrowed to 5 results for: pBabe-Puro Retroviral Vector

Showing: 1 - 5 of 5 results
  1. The 10 Most Distributed Plasmid Technologies in Addgene's First 10 Years

    Type
    Blog Post
    ... control, and empty backbones such as pBABE-puro for retroviral expression and pLVTHM, a lentiviral plasmid...shRNA expression, such as pLKO.1 puro and pLKO.1 – TRC cloning vector. Lentiviral Plasmids -  If you're... Our first popular "kit," Andrew Fire's set of vectors for C. elegans research was our most requested ...requests grow for lentiviral packaging and expression vectors, including pMD2.G and psPAX2. Actually, these two...
  2. Retrovirus Plasmids

    Type
    Collection
    ... gamma-retroviral transfer, packaging, and envelope plasmids. Read our Gamma-retroviral Vector Guide for...about gamma-retroviral components, viral production, and viral safety. Gamma-Retroviral Vector Guide Popular...Additional Resources Gamma-Retroviral Vector Guide All Viral Plasmids Viral Vectors 101 eBook Biosafety Resource...types. Wild-type gamma-retroviruses have been engineered into gamma-retroviral vectors for safe use in the... Viral Plasmids Gamma-Retroviral Plasmids Gamma-Retroviral Plasmids Transfer Plasmids Packaging ...Popular Gamma-Retroviral Transfer Plasmids Want a retroviral plasmid with your gene of interest? Search...database for retroviral transfer plasmids that have inserts. ID Plasmid 5'LTR Description PI 1780 pBABE-neo largeTcDNA...
  3. Plasmids 101: Multicistronic Vectors

    Type
    Blog Post
    ...MSCV-IRES-EGFP IRES Retroviral pMSCV-pBabeMCS-IRES-RFP IRES Retroviral pMSCV-IRES-YFP II IRES Retroviral pCMMP-MCS-IRES-Puro...pCMMP-MCS-IRES-Puro IRES Retroviral pEF1a-IRES-Neo IRES Mammalian MSCV-IRES-Luciferase IRES Retroviral pWPI... the creation of bicistronic or multicistronic vectors. Unlike promoters which will create unique mRNA...for each gene that is expressed, multicistronic vectors simultaneously express two or more separate proteins...blog post we’ll cover basics of multicistronic vectors: why they are useful, how they work, and how to...get started with them. Why Use multicistronic vectors? Detecting cells that are expressing your gene,...expressing your gene of interest at high levels. Unlike vectors that express screenable or selectable markers from...
  4. Sequencing Primers

    Type
    Guide
    ...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...inserts in pBMN retroviral vector MMLV sequence, for inserts in pBMN retroviral vector Forward pBR322ori-F...virus Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD ...Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC...pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT...ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Massague 58261 pBabe-FLAG-Neuroserpin SERPINI1 Flag Dementia Joan Massague 58262 pBabe-Puro-FLAG-Neuroserpin... Bjorkman 11503 pBabe neo human Frataxin FXN Friedreich ataxia Ronald Kahn 11504 pBabe hygro human Frataxin...Frataxin FXN Friedreich ataxia Ronald Kahn 11505 pBabe puro human Frataxin FXN Friedreich ataxia Ronald Kahn...Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan Massague 58260 pBabe-Neuroserpin oloop SERPINI1...Huda Zoghbi 92203 pBABE-delta-Syn-nYFP SNCA YFP CMV Parkinson's Huda Zoghbi 92204 pBABE-Tau-nYFP MAPT YFP...115182 pLD-puro-Cc-PARK7WT-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115183 pLD-puro-Cc-PARK7V51G-VA... pLD-puro-Cc-PARK7C53A-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115185 pLD-puro-Cc-PARK7H126A-VA...
Showing: 1 - 5 of 5 results