Skip to main content
Addgene
Showing: 1 - 19 of 19 results
  1. Tips for CRISPR Gene Editing in Mice

    Type
    Blog Post
    ...cassette. (b) pCAG-EGxxFP target plasmid and pX330-sgRNA plasmid (Mashiko et al. 2013). The pCAG-EGxxFP target...cloned directionally into the BbsI site. (c) The pCAG-EGxxFP target plasmid was co-transfected with pX330...Once amplified, you can insert this region into a pCAG-EGXXFP plasmid using standard cloning techniques...of transfecting HEK293T cells with your modified pCAG-EGXXFP plasmid along with the individual gRNAs in...Remember the primers you designed to generate your pCAG-EGXXFP plasmid? They are the perfect primer sets...
  2. Cre-lox system

    Type
    Collection
    ...Scholer 125574 pCAG-Cre Cre CAG Mammalian Imai 125577 pCAG-iCre iCre CAG Mammalian Imai 125748 pCAG-sfGFP-GSAx9...Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian Cepko 13776 pCAG-Cre:GFP Cre-GFP fusion CAG ...Lentiviral Fuchs 26646 pCAG-Cre-IRES2-GFP Cre and GFP coexpression CAG Mammalian Chenn 26647 pCAG-Cre Cre CAG Mammalian...51267 pCAG-Co-InCreN N-terminal component of the Co-InCre system CAG Mammalian Pelczar 51268 pCAG-Co-InCreC...69572 pCAG-N-CretrcintG Cre recombinase dependent on GFP (CRE-DOG) CAG Mammalian Cepko 69573 pCAG-C-CreintG...Pu 87694 pCAG-ERT2-PhoCl-Cre-PhoCl-ERT2 light-activated Cre cTnT Mammalian Campbell 89573 pCAG-iCre iCre...Mammalian Heller 112618 pCAG-VHC Venus, Cre-ERT2 CAG Mammalian Heller 112619 pCAG-EHC Emerald, Cre-ERT2 ...
  3. TALEN Plasmids and Kits

    Type
    Collection
    ...Golden Gate TALEN 2.0 37184 pCAG-T7-TALEN(Sangamo)-Destination Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination...mutations) FokI domains. 40131 pCAG-T7-TALEN(Sangamo)-FokI-KKR-Destination 40132 pCAG-T7-TALEN(Sangamo)-FokI-...robust cleavage activity in several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors are available...assembly. Destination vectors, pcDNA-TAL-NC2 and pCAGGS-TAL-NC2, are mammalian expression/mRNA synthesis...
  4. Retrovirus Plasmids

    Type
    Collection
    ...35617 pCAG-Eco Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG ...
  5. Arf GTPase Family

    Type
    Collection
    ...1849 Mammalian (pcDNA4c, pCAG), Gateway GEF Arfgef2 10564 1785 Mammalian (pCAG), Gateway GEF Iqsec1 9922...
  6. Sequencing Primers

    Type
    Guide
    ...BamHI, reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer...
  7. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...ALL864 51503-AAV1 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE...Control Karl Deisseroth AV-1-ALL854 51502-AAV1 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-1-PV0102 ...Control Karl Deisseroth AV-2-ALL854 51502-AAV2 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-2-PV0101 ...Control Karl Deisseroth AV-9-ALL854 51502-AAV9 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-9-PV0101 ...
  8. Lentivirus Plasmids

    Type
    Collection
    ...35617 pCAG-Eco N/A Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG...
  9. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...pCS2TAL3-RR Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination series, pCAG-Golden-Gate-Esp3I-Destination...pCAG-Golden-Gate-Esp3I-Destination Takashi Yamamoto pcDNA-TAL-NC2, pCAGGS-TAL-NC2 Charles Gersbach pcDNA3.1-GoldenGate, pcDNA3.1...
  10. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...to dimerization pcDNA3-CFP - Mammalian Expression pCAG-CFP - Mammalian Expression Cerulean 433 475 27 4.7... dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian Expression pLV-eGFP - Mammalian ... Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian Expression DsRed2-N1 - Mammalian... - Mammalian Expression HcRed1 588 618 0.3 Dimer pCAG-HcRed - Mammalian Expression HcRed1-N1 - Mammalian...530 68 5.9 Monomer pJL-mGold - Yeast Expression pCaggs-mGold - Mammalian Expression mCitrine 516 529 59...
  11. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...FUmGW Membrane Palmitoylation GFP Connie Cepko 14757 pCAG-mGFP Membrane Palmitoylation sequence from GAP43...Actin Filaments LifeAct mCherry Robin Shaw 21948 pCAG-mGFP-Actin Actin Filaments beta-actin EGFP Ryohei... NLS YFP IX Nucleus NLS YFP Connie Cepko 158000 pCaggs-NLS-PAmCherry1-GSS-EGFP Nucleus NLS mGold Francois...
  12. Control AAV Preps

    Type
    Collection
    ... Cre dependent 1, 2, 5, 8, 9, rg* Roth 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8...
  13. Retrograde AAV viral preps

    Type
    Collection
    ...37825 AAV-CAG-GFP CAG GFP Control Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control Zeng...
  14. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pScarlet-Kif5a KIF5A mScarlet CMV ALS Beverly Koller 118745 pCAG-Scarlet-Kif5a KIF5A mScarlet CAG ALS Beverly Koller...Spinocerebellar ataxia 6 Annette Dolphin 206076 Cav2.1 HA pCAGGS CACNA1A HA CMV Spinocerebellar ataxia 6 Annette...HA EI,II,III,IVA (E320A, E670A, E1411A, E1707A) pCAGGS CACNA1A HA CMV Spinocerebellar ataxia 6 Annette...
Showing: 1 - 19 of 19 results