Skip to main content

We narrowed to 18 results for: pCAG

Showing: 1 - 18 of 18 results
  1. Tips for CRISPR Gene Editing in Mice

    Type
    Blog Post
    ...cassette. (b) pCAG-EGxxFP target plasmid and pX330-sgRNA plasmid (Mashiko et al. 2013). The pCAG-EGxxFP target...cloned directionally into the BbsI site. (c) The pCAG-EGxxFP target plasmid was co-transfected with pX330...Once amplified, you can insert this region into a pCAG-EGXXFP plasmid using standard cloning techniques...of transfecting HEK293T cells with your modified pCAG-EGXXFP plasmid along with the individual gRNAs in...Remember the primers you designed to generate your pCAG-EGXXFP plasmid? They are the perfect primer sets...
  2. TALEN Plasmids and Kits

    Type
    Collection
    ...Golden Gate TALEN 2.0 37184 pCAG-T7-TALEN(Sangamo)-Destination Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination...mutations) FokI domains. 40131 pCAG-T7-TALEN(Sangamo)-FokI-KKR-Destination 40132 pCAG-T7-TALEN(Sangamo)-FokI-...robust cleavage activity in several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors are available...assembly. Destination vectors, pcDNA-TAL-NC2 and pCAGGS-TAL-NC2, are mammalian expression/mRNA synthesis...
  3. Retrovirus Plasmids

    Type
    Collection
    ...-expressing envelope plasmid. Didier Trono 35617 pCAG-Eco Ecotropic MLV expressing envelope plasmid. Arthur... Arthur Nienhuis and Patrick Salmon 35616 pCAG-VSVG VSV-G-expressing envelope plasmid. Arthur Nienhuis...
  4. Sequencing Primers

    Type
    Guide
    ...BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F...
  5. Arf GTPase Family

    Type
    Collection
    ... Mammalian (pcDNA4c, pCAG), Gateway GEF Arfgef2 (BIG2) 10564 1785 Mammalian (pCAG), Gateway GEF Arfgef3...
  6. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...ALL864 51503-AAV1 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE...Control Karl Deisseroth AV-1-ALL854 51502-AAV1 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-1-PV0102 ...Control Karl Deisseroth AV-2-ALL854 51502-AAV2 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-2-PV0101 ...Control Karl Deisseroth AV-9-ALL854 51502-AAV9 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-9-PV0101 ...
  7. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...pCS2TAL3-RR Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination series, pCAG-Golden-Gate-Esp3I-Destination...pCAG-Golden-Gate-Esp3I-Destination Takashi Yamamoto pcDNA-TAL-NC2, pCAGGS-TAL-NC2 Charles Gersbach pcDNA3.1-GoldenGate, pcDNA3.1...
  8. Lentivirus Plasmids

    Type
    Collection
    ...packaging construct encoding tat . Jakob Reiser 35617 pCAG-Eco Ecotropic MLV expressing envelope plasmid. Arthur...packaging construct encoding tat . Jakob Reiser 35616 pCAG-VSVG VSV-G-expressing envelope plasmid. Arthur Nienhuis...
  9. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...to dimerization pcDNA3-CFP - Mammalian Expression pCAG-CFP - Mammalian Expression mCerulean 433 475 27 ... dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian Expression pLV-eGFP - Mammalian ... Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian Expression DsRed2-N1 - Mammalian... - Mammalian Expression HcRed1 588 618 0.3 Dimer pCAG-HcRed - Mammalian Expression HcRed1-N1 - Mammalian...530 68 5.9 Monomer pJL-mGold - Yeast Expression pCaggs-mGold - Mammalian Expression mGold2s 517 529 90...Bacterial Expression pJL-mGold2s - Yeast Expression pCaggs-mGold2s - Mammalian Expression mGold2t 515 527 ...Bacterial Expression pJL-mGold2t - Yeast Expression pCaggs-mGold2t - Mammalian Expression mCitrine 516 529...
  10. Tetracycline Inducible Expression

    Type
    Collection
    ...with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON-3G Mammalian expression of the Tet-On 3G transactivator...viral tTA plasmids. tTA Viviana Gradinaru 104102 pCAG-tTA Mammalian expression of tTA from the CAG promoter...
  11. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Membranes Palmitoylation EGFP Connie Cepko 14757 pCAG-mGFP Membranes Palmitoylation sequence from GAP43...Actin filaments LifeAct mCherry Robin Shaw 21948 pCAG-mGFP-Actin Actin filaments beta-Actin EGFP Ryohei...
  12. Control AAV Preps

    Type
    Collection
    ...dependent 1, 2, 5, 8, 9, rg* Bryan Roth 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8...
  13. Retrograde AAV viral preps

    Type
    Collection
    ...-CAG-GFP CAG GFP Control Edward Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control Hongkui...
  14. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pScarlet-Kif5a KIF5A mScarlet CMV ALS Beverly Koller 118745 pCAG-Scarlet-Kif5a KIF5A mScarlet CAG ALS Beverly Koller...mCerulean TARDBP mCerulean CMV ALS Jennifer Lee 216709 pCAG-TSF-TBK1 TBK1 TSF CAG ALS James Hurley 216843 pET-Duet_OPTN-thrombin-GST...Spinocerebellar ataxia 6 Annette Dolphin 206076 Cav2.1 HA pCAGGS CACNA1A HA CMV Spinocerebellar ataxia 6 Annette...HA EI,II,III,IVA (E320A, E670A, E1411A, E1707A) pCAGGS CACNA1A CMV Spinocerebellar ataxia 6 Annette Dolphin...
Showing: 1 - 18 of 18 results