We narrowed to 19 results for: pCAG
-
TypeBlog Post...cassette. (b) pCAG-EGxxFP target plasmid and pX330-sgRNA plasmid (Mashiko et al. 2013). The pCAG-EGxxFP target...cloned directionally into the BbsI site. (c) The pCAG-EGxxFP target plasmid was co-transfected with pX330...Once amplified, you can insert this region into a pCAG-EGXXFP plasmid using standard cloning techniques...of transfecting HEK293T cells with your modified pCAG-EGXXFP plasmid along with the individual gRNAs in...Remember the primers you designed to generate your pCAG-EGXXFP plasmid? They are the perfect primer sets...
-
New and Upcoming Viral Vectors - December 2019
TypeBlog Post...collection! Plasmid Serotype Name 51502 AAV5 pCAG-FLEX-EGFP-WPRE 114471 AAV1, AAV5 pAAV-Ef1a-fDIO... -
New and Upcoming Viral Vectors - September 2019
TypeBlog Post...promoter directs broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE (51502-AAV5): The CAG promoter directs... -
Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View
TypeBlog Post...binding domain (LDB) to the C-terminus of FLP or Cre (pCAG-CreERT2 #14797). These Cre/ FLP versions are retained... -
TALEN Plasmids and Kits
TypeCollection...Golden Gate TALEN 2.0 37184 pCAG-T7-TALEN(Sangamo)-Destination Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination...mutations) FokI domains. 40131 pCAG-T7-TALEN(Sangamo)-FokI-KKR-Destination 40132 pCAG-T7-TALEN(Sangamo)-FokI-...robust cleavage activity in several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors are available...assembly. Destination vectors, pcDNA-TAL-NC2 and pCAGGS-TAL-NC2, are mammalian expression/mRNA synthesis... -
Retrovirus Plasmids
TypeCollection...-expressing envelope plasmid. Didier Trono 35617 pCAG-Eco Ecotropic MLV expressing envelope plasmid. Arthur... Arthur Nienhuis and Patrick Salmon 35616 pCAG-VSVG VSV-G-expressing envelope plasmid. Arthur Nienhuis... -
Sequencing Primers
TypeGuide...BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F... -
Arf GTPase Family
TypeCollection... Mammalian (pcDNA4c, pCAG), Gateway GEF Arfgef2 (BIG2) 10564 1785 Mammalian (pCAG), Gateway GEF Arfgef3... -
27 Hot Plasmids from 2016
TypeBlog Post...pCS2TAL3-RR Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination series, pCAG-Golden-Gate-Esp3I-Destination...pCAG-Golden-Gate-Esp3I-Destination Takashi Yamamoto pcDNA-TAL-NC2, pCAGGS-TAL-NC2 Charles Gersbach pcDNA3.1-GoldenGate, pcDNA3.1... -
Penn Vector Core Partnership with Addgene
TypeCollection...ALL864 51503-AAV1 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE...Control Karl Deisseroth AV-1-ALL854 51502-AAV1 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-1-PV0102 ...Control Karl Deisseroth AV-2-ALL854 51502-AAV2 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-2-PV0101 ...Control Karl Deisseroth AV-9-ALL854 51502-AAV9 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-9-PV0101 ... -
Lentivirus Plasmids
TypeCollection...packaging construct encoding tat . Jakob Reiser 35617 pCAG-Eco Ecotropic MLV expressing envelope plasmid. Arthur...packaging construct encoding tat . Jakob Reiser 35616 pCAG-VSVG VSV-G-expressing envelope plasmid. Arthur Nienhuis... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...to dimerization pcDNA3-CFP - Mammalian Expression pCAG-CFP - Mammalian Expression mCerulean 433 475 27 ... dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian Expression pLV-eGFP - Mammalian ... Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian Expression DsRed2-N1 - Mammalian... - Mammalian Expression HcRed1 588 618 0.3 Dimer pCAG-HcRed - Mammalian Expression HcRed1-N1 - Mammalian...530 68 5.9 Monomer pJL-mGold - Yeast Expression pCaggs-mGold - Mammalian Expression mGold2s 517 529 90...Bacterial Expression pJL-mGold2s - Yeast Expression pCaggs-mGold2s - Mammalian Expression mGold2t 515 527 ...Bacterial Expression pJL-mGold2t - Yeast Expression pCaggs-mGold2t - Mammalian Expression mCitrine 516 529... -
Tetracycline Inducible Expression
TypeCollection...with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON-3G Mammalian expression of the Tet-On 3G transactivator...viral tTA plasmids. tTA Viviana Gradinaru 104102 pCAG-tTA Mammalian expression of tTA from the CAG promoter... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...target sequence in between two fragments of EGFP in pCAG-EGxxFP. The EGFP fragments contain 482bp of overlapping... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Membranes Palmitoylation EGFP Connie Cepko 14757 pCAG-mGFP Membranes Palmitoylation sequence from GAP43...Actin filaments LifeAct mCherry Robin Shaw 21948 pCAG-mGFP-Actin Actin filaments beta-Actin EGFP Ryohei... -
Control AAV Preps
TypeCollection...dependent 1, 2, 5, 8, 9, rg* Bryan Roth 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Mb Cpf1 Kim pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6... -
Retrograde AAV viral preps
TypeCollection...-CAG-GFP CAG GFP Control Edward Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control Hongkui... -
Neurodegeneration Plasmid Collection
TypeCollection...pScarlet-Kif5a KIF5A mScarlet CMV ALS Beverly Koller 118745 pCAG-Scarlet-Kif5a KIF5A mScarlet CAG ALS Beverly Koller...mCerulean TARDBP mCerulean CMV ALS Jennifer Lee 216709 pCAG-TSF-TBK1 TBK1 TSF CAG ALS James Hurley 216843 pET-Duet_OPTN-thrombin-GST...Spinocerebellar ataxia 6 Annette Dolphin 206076 Cav2.1 HA pCAGGS CACNA1A HA CMV Spinocerebellar ataxia 6 Annette...HA EI,II,III,IVA (E320A, E670A, E1411A, E1707A) pCAGGS CACNA1A HA CMV Spinocerebellar ataxia 6 Annette...