We narrowed to 14 results for: pCAG-Cre: GFP vector

... took place and reconstituted the EGFP expression cassette. (b) pCAG-EGxxFP target plasmid and pX330-sgRNA...Mashiko et al. 2013). The pCAG-EGxxFP target plasmid contains overlapping 5′ and 3′ EGFP fragments under the...cloned directionally into the BbsI site. (c) The pCAG-EGxxFP target plasmid was co-transfected with pX330...Once amplified, you can insert this region into a pCAG-EGXXFP plasmid using standard cloning techniques...of transfecting HEK293T cells with your modified pCAG-EGXXFP plasmid along with the individual gRNAs in...Remember the primers you designed to generate your pCAG-EGXXFP plasmid? They are the perfect primer sets to ...clone the PCR products into a pBluescript cloning vector and sequence the resulting plasmid. It can take...

...Flp-dependent Cre AAV in AAV9 and AAVrg. See our new additions here: Cre vectors pAAV-EF1a-fDIO-Cre (121675...expression. This is a Cre-dependent switch that expresses nuclear mCherry in the absence of Cre, and expresses... Flp vectors pAAV-EF1a-mCherry-IRES-Flpo (55634-AAV1) pAAV-EF1a-Flpo (55637-AAV1) Viral vectors coming... of our viral vectors blog posts Find tips for preparing AAVs Download our viral vectors 101 eBook Resources...collection is now complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465) are now available...pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE...expresses nuclear EGFP in the presence of Cre. Biosensor AAV (calcium sensors and GABA sensors) Calcium sensors...

...pAAV.hSynapsin.SF-iGluSnFR.A184S Viral vectors coming soon! These vectors should be packaged and available ... of our viral vectors blog posts Find tips for preparing AAVs Download our viral vectors 101 eBook Resources...collection! Plasmid Serotype Name 51502 AAV5 pCAG-FLEX-EGFP-WPRE 114471 AAV1, AAV5 pAAV-Ef1a-fDIO mCherry...new tools to our inventory of ready-to-use viral vectors. Here are some of the AAV we have released in the...pAAV-hSyn Con/Fon hChR2(H134R)-EYFP that is both Cre and Flp dependent. Plasmid Serotype Name 124603...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP   Biosensor AAV...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Recombinases Plasmid Serotype...

...dim GFPs The availability of the three dimensional structure of GFP, its brighter mutant S65T-GFP, and...carrying the R26DsRedR; CRUSH-GFP; and Nestin-Cre alleles showed efficient GFP knockdown in eyes and clonogenic... existing transposon and vector systems and creating an all-synthetic vector that included only the elements...compatible Level 0 vectors are directionally assembled into a Level 1 vector creating a single transcriptional... into a destination vector in a predefined order. Finally, the destination vectors are used with Multisite... eight entry vectors can be used for each Multisite Gateway compatible destination vector for a maximum... These vectors, termed RUSH (For ROSA26 U6 short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated...

...Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in mammalian...Weinberg 10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression with GFP expression. See plasmid...James Iglehart 20672 MSCV-IRES-GFP MSCV For transgene expression with a GFP marker. Tannishtha Reya 21654... Resources Gamma-Retroviral Vector Guide All Viral Plasmids Viral Vectors 101 eBook Biosafety Resource...Puro IRES GFP empty plasmid) MSCV For cloning and gene expression. Select with puromycin or screen for GFP...pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression plasmid. Deletion of dsRed by Cre recombinase...gamma-retroviruses have been engineered into gamma-retroviral vectors for safe use in the lab. The gamma-retrovirus components...

...Viral Vector Packaging Service Penn Vector Core Transfer Viral Vector Packaging Service: Penn Vector Core...AAV vectors to the academic research community. The Penn Vector Core produced viral-based vectors for ...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-9-PV2394 107788-AAV9 AAV.rTH.PI.Cre.SV40 Cre Recombinase...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-5-PV2396 105558-AAV5 pENN.AAV.CamKII 0.4.Cre.SV40 Cre Recombinase....Pl.Cre.rBG Cre Recombinase James M. Wilson AV-8-PV1091 107787-AAV8 AAV.TBG.PI.Cre.rBG Cre Recombinase...pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-9-PV2676 105553-AAV9 pENN.AAV.hSyn.Cre.WPRE.hGH Cre Recombinase...Transfer The University of Pennsylvania Vector Core (Penn Vector Core) and Addgene previously partnered...

...expression vectors with various promoters suitable for in vivo expression, and/or produce vectors to make...pCS2TAL3-RR Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination series, pCAG-Golden-Gate-Esp3I-Destination...prototrophic strains. The vectors were based on the original EasyClone vectors (Jensen et al 2013) allow...donor vectors containing mAID and either Neo or Hygro resistance markers with CRISPR/Cas vectors targeting...destination vectors using low-cost, one-pot golden gate cloning that results in the creation of many E....address this problem, Csaba Pál’s lab has created a set of vectors that allows one to use the MAGE method... the mAID vectors come with mCherry2 or mClover fluorescent proteins allowing you to screen for fusions...

...engineered into viral vectors for safe use in the lab. One safety feature of lentiviral vectors is that the components... pSico 3rd Conditional (Cre-lox), stable expression of shRNAs; addition of Cre turns on shRNA expression...Sabatini 171123 pLVX-TetOne-Puro-GFP 3rd Dox-inducible expression of GFP. Jason Sheltzer 20342 FUW-M2rtTA...hUbC-driven EGFP. Can be used for cDNA expression. David Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA...Brindle and Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin...plasmids available at Addgene. Read our Lentiviral Vector Guide for more information about lentiviral components... viral production, and viral safety. Lentiviral Vector Guide Popular Lentiviral Transfer Plasmids Looking...

...63704 pRetroX GFP T2A Cre Retroviral vector for dox-inducible expression of GFP T2A Cre recombinase. Floris...85040 pK170.AAV-TRE-Cre-WPRE (Supernova) AAV vector for dox-inducible expression of Cre recombinase. Takuji...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS...Neo-TRE-CMV-Cre-rtTA Dox-inducible expression of Cre recombinase. Madeline Lancaster 198752 DiLiCre 2.0 Dox-inducible...plasmid. A single vector approach may not have as much flexibility and control as a dual vector design, but ...popular empty backbones, expression vectors for transactivators, and vectors for other applications, or search...

...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Viviana Gradinaru 116869 pAAV-CAG-H2B-GFP CAG H2B-GFP Constitutive...mCherry Cre dependent 1, 2, 5, 8, 9, rg* Bryan Roth 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent... Flp-dependent Cre and Flp-dependent Cre, Flp, and VCre-dependent Constitutive (non-cre-dependent) Clear...Viviana Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Gordon Fishell...EF1a mScarlet Cre dependent 1, 5 Karl Deisseroth 50457 pAAV-hSyn-DIO-EGFP hSyn EGFP Cre dependent 1, 2...-CAG-FLEX-EGFP CAG EGFP Cre dependent 1 Ian Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent...dTomato Cre dependent 1, 2, 5, 9, rg* Gordon Fishell 100043 pAAV.synP.DIO.EGFP.WPRE.hGH Syn EGFP Cre dependent...

...Expression EGFP 488 507 34 6 25 min Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...Expression (this is a bicistronic vector rather than a fusion protein vector) ZsGreen1-N1 - Mammalian Expression...Mammalian Gateway Destination Vector pENTR4-HaloTag (w876-1) - Gateway Entry Vector pCS2+/C-Halo , pCS2+/N-Halo...Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus Expression pSNAP-tag (T7) Vector - Bacterial...pCLIP-tag (m) Vector - Mammalian Expression pENTR4-CLIPf (w877-2) - Gateway Entry Vector pET51b-His-TEV-CLIP-tag...Mammalian Expression HcRed1 588 618 0.3 Dimer pCAG-HcRed - Mammalian Expression HcRed1-N1 - Mammalian Expression...Mammalian Expression sfGFP (superfolder GFP) 485 507 54 14 min Prone to dimerization sfGFP-N1 - Mammalian Expression...

...37825 AAV-CAG-GFP CAG GFP Control Edward Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control...pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Gordon Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control...AAV-pgk-Cre PGK Cre expression Recombinases Patrick Aebischer 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a Cre...pAAV-hSyn-DIO-EGFP Syn EGFP, Cre-dependent Control Bryan Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent...105547 pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control James M. Wilson 116869 pAAV-CAG-H2B-GFP CAG GFP Control...James M. Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP-tagged Cre expression Recombinases...pENN.AAV.CamKII 0.4.Cre.SV40 CamKII Cre expression Recombinases James M. Wilson 107738 pAAV-hSyn-Cre-P2A-dTomato...

...activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward GFP-R CCATCTAATTCAACAAGAATTGGGACAAC... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...