... took place and reconstituted the EGFP expression cassette. (b) pCAG-EGxxFP target plasmid and pX330-sgRNA...Mashiko et al. 2013). The pCAG-EGxxFP target plasmid contains overlapping 5′ and 3′ EGFP fragments under the...cloned directionally into the BbsI site. (c) The pCAG-EGxxFP target plasmid was co-transfected with pX330...Once amplified, you can insert this region into a pCAG-EGXXFP plasmid using standard cloning techniques...of transfecting HEK293T cells with your modified pCAG-EGXXFP plasmid along with the individual gRNAs in...Remember the primers you designed to generate your pCAG-EGXXFP plasmid? They are the perfect primer sets to ...clone the PCR products into a pBluescript cloning vector and sequence the resulting plasmid. It can take...

...Flp-dependent Cre AAV in AAV9 and AAVrg. See our new additions here: Cre vectors pAAV-EF1a-fDIO-Cre (121675...expression. This is a Cre-dependent switch that expresses nuclear mCherry in the absence of Cre, and expresses... Flp vectors pAAV-EF1a-mCherry-IRES-Flpo (55634-AAV1) pAAV-EF1a-Flpo (55637-AAV1) Viral vectors coming... of our viral vectors blog posts Find tips for preparing AAVs Download our viral vectors 101 eBook Resources...collection is now complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465) are now available...pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE...expresses nuclear EGFP in the presence of Cre. Biosensor AAV (calcium sensors and GABA sensors) Calcium sensors...

...pAAV.hSynapsin.SF-iGluSnFR.A184S Viral vectors coming soon! These vectors should be packaged and available ... of our viral vectors blog posts Find tips for preparing AAVs Download our viral vectors 101 eBook Resources...collection! Plasmid Serotype Name 51502 AAV5 pCAG-FLEX-EGFP-WPRE 114471 AAV1, AAV5 pAAV-Ef1a-fDIO mCherry...new tools to our inventory of ready-to-use viral vectors. Here are some of the AAV we have released in the...pAAV-hSyn Con/Fon hChR2(H134R)-EYFP that is both Cre and Flp dependent. Plasmid Serotype Name 124603...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP   Biosensor AAV...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Recombinases Plasmid Serotype...

...48201 CAG-GFP-IRES-CRE Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG...recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian Cepko 13776 pCAG-Cre:GFP Cre-GFP fusion...25997 LV-Cre pLKO.1 Cre and shRNA coexpression CMV Lentiviral Fuchs 26646 pCAG-Cre-IRES2-GFP Cre and GFP...promoterless CRE-GFP fusion none Mammalian Sauer 11960 pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion ...-CW-CRE Cre CMV Lentiviral Trono 12265 pHR-CMV-nlsCRE Cre CMV Lentiviral Trono 12493 p259 pCMV-CRE-M (...13777 pCAG-ERT2CreERT2 ERT2-Cre-ERT2-Tamoxifen inducible CAG Mammalian Cepko 13779 pRho-Cre Cre-Myc rhodopsin...pOG231 NLS-Cre CMV Mammalian Wahl 19131 pIC-Cre Cre Bacterial Rajewsky 22776 MSCV CreERT2 puro Cre-ERT2 - ...

...dim GFPs The availability of the three dimensional structure of GFP, its brighter mutant S65T-GFP, and...carrying the R26DsRedR; CRUSH-GFP; and Nestin-Cre alleles showed efficient GFP knockdown in eyes and clonogenic... existing transposon and vector systems and creating an all-synthetic vector that included only the elements...compatible Level 0 vectors are directionally assembled into a Level 1 vector creating a single transcriptional... into a destination vector in a predefined order. Finally, the destination vectors are used with Multisite... eight entry vectors can be used for each Multisite Gateway compatible destination vector for a maximum... These vectors, termed RUSH (For ROSA26 U6 short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated...

...Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in mammalian...MSCV-IRES-GFP MSCV For transgene expression and GFP marker Reya 21654 pMSCV PIG (Puro IRES GFP empty plasmid...35617 pCAG-Eco Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG ...Weinberg 10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression; also expresses GFP. See pMKO.1 puro...select with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional...Biosafety Guide Lentiviral Plasmids AAV Plasmids Viral Vectors 101 eBook γ-Retrovirus (gamma-retrovirus) is an...Conditional overexpression plasmid; deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and...

...expression vectors with various promoters suitable for in vivo expression, and/or produce vectors to make...pCS2TAL3-RR Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination series, pCAG-Golden-Gate-Esp3I-Destination...prototrophic strains. The vectors were based on the original EasyClone vectors (Jensen et al 2013) allow...donor vectors containing mAID and either Neo or Hygro resistance markers with CRISPR/Cas vectors targeting...destination vectors using low-cost, one-pot golden gate cloning that results in the creation of many E....address this problem, Csaba Pál’s lab has created a set of vectors that allows one to use the MAGE method... the mAID vectors come with mCherry2 or mClover fluorescent proteins allowing you to screen for fusions...

...Viral Vector Packaging Service Penn Vector Core Transfer Viral Vector Packaging Service: Penn Vector Core...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-9-PV2394 107788-AAV9 AAV.rTH.PI.Cre.SV40 Cre Recombinase...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-5-PV2396 105558-AAV5 pENN.AAV.CamKII 0.4.Cre.SV40 Cre Recombinase....Pl.Cre.rBG Cre Recombinase James M. Wilson AV-8-PV1091 107787-AAV8 AAV.TBG.PI.Cre.rBG Cre Recombinase...pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 Cre Recombinase James M. Wilson AV-9-PV2676 105553-AAV9 pENN.AAV.hSyn.Cre.WPRE.hGH Cre Recombinase...University of Pennsylvania Vector Core (Link opens in a new window) (Penn Vector Core) and Addgene have partnered...provide high-quality AAV vectors to the academic research community. The Penn Vector Core will produce viral-based...

...Bacterial Vectors - Includes tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial...Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...bicistronic vector rather than a fusion protein vector) ZsGreen1-N1 - Mammalian Expression SGFP2 495 512 ...Expression pRSETA-PAGFP - Bacterial Expression tandem PA-GFP-KanR - Yeast Expression pFA6a-PA-GFP-kanMX6 - Yeast...Expression pFA6a-link-yEPAGFP-CaUra3 - Yeast Expression mPA-GFP-N1 - Mammalian Expression mPA-GFP-C1 - Mammalian...then scientists have engineered numerous GFP-variants and non-GFP proteins that result in a diverse set ...Mammalian Expression HcRed1 588 618 0.3 Dimer pCAG-HcRed - Mammalian Expression HcRed1-N1 - Mammalian Expression...

...Packaging part of the FELIX vector system, expresses Gag-Pol and Rev Nolan 35617 pCAG-Eco N/A Envelope Ecotropic... pSico 3rd Conditional (Cre-lox), stable expression of shRNAs; addition of Cre turns on shRNA expression...article for more cre-lox shRNA expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can ...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG N/A Envelope VSV-G-expressing envelope plasmid...expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...

...hSyn mCherry Cre dependent 1, 2, 5, 8, 9, rg* Roth 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent ... Flp-dependent Cre and Flp-dependent Cre, Flp, and VCre-dependent Constitutive (non-cre-dependent) Clear...PHP.V1 Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive...mScarlet EF1a mScarlet Cre dependent 1, 5 Deisseroth 50457 pAAV-hSyn-DIO-EGFP hSyn EGFP Cre dependent 1, 2, ...pAAV-CAG-FLEX-EGFP CAG EGFP Cre dependent 1 Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent PHP.V1...dTomato Cre dependent 1, 2, 5, 9, rg* Fishell 100043 pAAV.synP.DIO.EGFP.WPRE.hGH Syn EGFP Cre dependent...

...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC...BamHI, reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ...

...PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control... pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control Fishell...0.4.Cre.SV40 CamKII Cre expression Recombinases Wilson 107738 pAAV-hSyn-Cre-P2A-dTomato Syn Cre expression...pAAV-hSyn-DIO-EGFP Syn EGFP, Cre-dependent Control Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-...Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP-tagged Cre expression Recombinases Wilson...expresses NLS-EGFP in Cre-positive cells. Control Harvey 137164 pAAV-nEF-Con/Fon/Von eYFP nEF EYFP, Cre, Flp and...pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control Wilson 24593 AAV-pgk-Cre PGK Cre expression Recombinases Aebischer...

...Cpf1 Kim pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA... Empty Vectors Many gRNA empty vectors have been deposited at Addgene. To find the gRNA vector for your...Multiplex gRNA Vectors Several systems have been developed to generate multiplex gRNA vectors. These systems...single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one vector, and plasmids...Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI...

... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...