Skip to main content

We narrowed to 16 results for: pCAG-EGFP

Showing: 1 - 16 of 16 results
  1. Tips for CRISPR Gene Editing in Mice

    Type
    Blog Post
    ...fluorescent protein (EGFP) reconstitution. (a) Scheme of validation for DSB mediated EGFP expression cassette... took place and reconstituted the EGFP expression cassette. (b) pCAG-EGxxFP target plasmid and pX330-sgRNA...Mashiko et al. 2013). The pCAG-EGxxFP target plasmid contains overlapping 5′ and 3′ EGFP fragments under the...halves of EGFP to recombine by homology directed repair, and resulting in the expression of EGFP. Using ...can be placed in multi-cloning site (MCS) between EGFP fragments. The pX330 plasmid contains humanized ...cloned directionally into the BbsI site. (c) The pCAG-EGxxFP target plasmid was co-transfected with pX330...Once amplified, you can insert this region into a pCAG-EGXXFP plasmid using standard cloning techniques...
  2. New and Upcoming Viral Vectors - September 2019

    Type
    Blog Post
    ...pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE...our entire AAV inventory. Our new AAVs include: EGFP-expressing AAV for serotype testing Calcium sensors... testing AAV, which are small (20 ul) samples of EGFP-expressing AAV packaged in various serotypes. This...complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465) are now available as 20 ul aliquots...interneurons. pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5 and 112677-AAVrg): The EF1a promoter...mCherry in the absence of Cre, and expresses nuclear EGFP in the presence of Cre. Biosensor AAV (calcium ...26976-AAV5) pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5) Calcium Sensors pGP-AAV-syn-jGCaMP7b-WPRE...
  3. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    ...collection! Plasmid Serotype Name 51502 AAV5 pCAG-FLEX-EGFP-WPRE 114471 AAV1, AAV5 pAAV-Ef1a-fDIO mCherry...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP   Biosensor AAV...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Recombinases Plasmid Serotype...
  4. Sequencing Primers

    Type
    Guide
    ...early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N CGTCGCCGTCCAGCTCGACCAG...factor-1α promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N CGTCGCCGTCCAGCTCGACCAG...CGTCGCCGTCCAGCTCGACCAG 5' end of EGFP Reverse EXFP-R GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse...BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F...CGTCGCCGTCCAGCTCGACCAG 5' end of EGFP Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...
  5. Retrovirus Plasmids

    Type
    Collection
    ...for GFP. David Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression plasmid...dsRed and the activation of the transgene fused to eGFP. Hans Clevers 18760 MSCV IRES Luciferase MSCV Plasmid...luciferase in mammalian cells. Alice Wong 83356 pMXs-3XHA-EGFP-OMP25 MoMSV For tagging mitochondria with HA epitopes...-expressing envelope plasmid. Didier Trono 35617 pCAG-Eco Ecotropic MLV expressing envelope plasmid. Arthur... Arthur Nienhuis and Patrick Salmon 35616 pCAG-VSVG VSV-G-expressing envelope plasmid. Arthur Nienhuis...
  6. Lentivirus Plasmids

    Type
    Collection
    ...more variants. Tyler Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion with puromycin resistance. Can ...Stephen Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...119816 pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase 3rd Expression of EGFP-Firefly luciferase fusion protein...14748 pLKO.3G 3rd U6-driven shRNA empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. ...expression. David Sabatini 14883 FUGW 3rd hUbC-driven EGFP. Can be used for cDNA expression. David Baltimore...3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor expression...silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor expression...
  7. Tetracycline Inducible Expression

    Type
    Collection
    ...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or...Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS Xiaojun Lian 171123 pLVX-TetOne-Puro-GFP...Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS Jason Sheltzer 11651 pLVUT-tTR-KRAB... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...expression (On or Off) of both your gene of interest and EGFP. Pbi contains a TRE between two minimal CMV promoters...with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON-3G Mammalian expression of the Tet-On 3G transactivator...Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced Mikhail ...
  8. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Palmitoylation EGFP Connie Cepko 14757 pCAG-mGFP Membranes Palmitoylation sequence from GAP43 EGFP Connie Cepko...Rab8 EGFP Maxence Nachury 35623 pEGFPN3-Sstr3 Primary cilia Sstr3 EGFP Kirk Mykytyn 35624 pEGFPN3-5ht6...Gadella 58473 pEGFP-C1 F-tractin-EGFP Actin filaments F-tractin EGFP Dyche Mullins 41147 pEGFP Centrin2 Centrioles...Primary cilia Htr6 EGFP Kirk Mykytyn 104358 pEGFP-N-Drd1 Primary cilia (Neurons) Drd1 EGFP Kirk Mykytyn *Fusions...Cortactin EGFP Anna Huttenlocher 32907 pEGFP-rNFM Intermediate filaments (neuronal) Nefm EGFP Anthony Brown...Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell cycle) Cep170 EGFP Erich... mCherry Gia Voeltz 118084 pLenti-EB1-EGFP Microtubules EB1 EGFP Ken-Ichi Takemaru 122871 GFP-hCCDC11 ...
  9. Control AAV Preps

    Type
    Collection
    ...pAAV-hSyn-EGFP hSyn EGFP Constitutive 1, 2, 5, 8, 9, 11, rg*, PHP.eB Bryan Roth 50469 pAAV-CaMKIIa-EGFP CaMKIIa...2, 5, 8, 9, rg* Bryan Roth 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8, 9, rg* Hongkui...TBG EGFP Constitutive 8 James M. Wilson 105542 pENN.AAV.CB7.CI.eGFP.WPRE.rBG CB7 EGFP Constitutive 1, 2,... dependent 2 Maarten Kole 190155 AAV_pMBP-EGFP-caax MBP EGFP-caax Constitutive 1, 8 Brad Zuchero 192552...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a NLS-mCherry or nls-EGFP Cre dependent 1, 2, 5, 8, 9, rg* Brandon...dependent 1, 5 Karl Deisseroth 50457 pAAV-hSyn-DIO-EGFP hSyn EGFP Cre dependent 1, 2, 5, 8, 9, rg* Bryan Roth...Hongkui Zeng 59331 pAAV-CAG-FLEX-EGFP CAG EGFP Cre dependent 1 Ian Wickersham 104052 pAAV-CAG-DIO-EYFP ...
  10. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...AAV2 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-2-PV0101 105530-AAV2 pAAV.CMV.PI.EGFP.WPRE.bGH Control...AAV9 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-9-PV0101 105530-AAV9 pAAV.CMV.PI.EGFP.WPRE.bGH Control... Karl Deisseroth AV-1-ALL854 51502-AAV1 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-1-PV0102 105531...ALL864 51503-AAV1 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE...pENN.AAV.CamKII0.4.eGFP.WPRE.rBG Control James M. Wilson AV-1-PV1963 105542-AAV1 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control...pENN.AAV.CamKII0.4.eGFP.WPRE.rBG Control James M. Wilson AV-5-PV1963 105542-AAV5 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control....GFA104.PI.eGFP.WPRE.bGH Control Philip Haydon AV-5-PV2407 105549-AAV5 pAAV.GFAP.eGFP.WPRE.hGH Control...
  11. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression EGFP 488 507 34 6 25 min Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...Expression pLV-eGFP - Mammalian Lentiviral Expression Ac5-STABLE1-neo - Insect Expression pCS2+8CeGFP - Zebrafish...Sea urchin pCS2+8NeGFP - Zebrafish/Xenopus/Worm/Sea urchin pKT0128 - Yeast Expression EGFP-pBAD - Bacterial...to dimerization pcDNA3-CFP - Mammalian Expression pCAG-CFP - Mammalian Expression mCerulean 433 475 27 ... Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian Expression DsRed2-N1 - Mammalian... - Mammalian Expression HcRed1 588 618 0.3 Dimer pCAG-HcRed - Mammalian Expression HcRed1-N1 - Mammalian...Bacterial Expression mEGFP 488 507 34 6 Monomer (A206K) pmEGFP-1 - Mammalian Expression mEGFP-N1 - Mammalian...
  12. Retrograde AAV viral preps

    Type
    Collection
    ...AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control Hongkui Zeng 50465 pAAV-hSyn-EGFP Syn EGFP Control...Control Bryan Roth 50469 pAAV-CaMKIIa-EGFP CamKII EGFP Control Bryan Roth 114472 pAAV-hSyn-mCherry Syn ...tdTomato Control Edward Boyden 50457 pAAV-hSyn-DIO-EGFP Syn EGFP, Cre-dependent Control Bryan Roth 55650 pAAV-hSyn...Control Viviana Gradinaru 105547 pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control James M. Wilson 116869 pAAV-CAG-H2B-GFP...Recombinases Karl Deisseroth 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn EGFP-tagged Cre expression Recombinases...Gradinaru 112677 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a Color-flipping switch. Expresses NLS-mCherry...NLS-mCherry in the absence of Cre, and expresses NLS-EGFP in Cre-positive cells. Control Brandon Harvey 137164...
  13. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...pCS2TAL3-RR Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination series, pCAG-Golden-Gate-Esp3I-Destination...Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They...pCAG-Golden-Gate-Esp3I-Destination Takashi Yamamoto pcDNA-TAL-NC2, pCAGGS-TAL-NC2 Charles Gersbach pcDNA3.1-GoldenGate, pcDNA3.1...
  14. Arf GTPase Family

    Type
    Collection
    ...Mammalian (pEGFP-N3), Gateway GEF Arfgef1 (BIG1, ARFGEP1) 10565 1849 Mammalian (pcDNA4c, pCAG), Gateway...Gateway GEF Arfgef2 (BIG2) 10564 1785 Mammalian (pCAG), Gateway GEF Arfgef3 (BIG3) 57221 2177 GEF Iqsec1 (BRAG2...EFA6) 5662 1024 Mammalian (pEGFP-C1) GEF Psd2 (EFA6C) 84249 771 Mammalian (pEGFP-C1), Gateway GEF Psd3 (EFA6D...GTPase Arl1 400 181 Bacterial (pET), Mammalian (pEGFP-N3) Gateway GTPase Arl2 402 184 Bacterial (pET),...116984 1704 GAP Arap3 (CENTD3) 64411 1544 Mammalian (pEGFP-C2) GAP Acap1 (CENTB1) 9744 740 Mammalian (pFLAG-CMV2...Bacterial (pET) GAP Git1 28964 770 Mammalian (pcDNA3, pEGFP) GAP Git2 (PKL, CAT2) 9815 759 GAP ELMOD1 55531 ...398 Gateway GEF Cyth2 (ARNO) 9266 400 Mammalian (pEGFP-C1), Gateway GEF Cyth3 (ARNO3, GRP1) 9265 399 Gateway...
  15. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1...14121 pcDNA3-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP...Dantuma 23971 VCP(wt)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23972 VCP(R155H)-EGFP VCP His, GFP, HA CMV...Dantuma 23973 VCP(A232E)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23974 VCP(DK0)-EGFP VCP His, GFP, HA CMV...Merrifield 28195 tdp43-EGFP construct2 TARDBP GFP CMV ALS Zuoshang Xu 28196 tdp43-EGFP construct3 TARDBP GFP...Zuoshang Xu 28197 tdp43-EGFP construct4 TARDBP GFP CMV ALS Zuoshang Xu 28198 tdp43-EGFP construct5 TARDBP GFP...Zuoshang Xu 28199 tdp43-EGFP construct6 TARDBP GFP CMV ALS Zuoshang Xu 28200 tdp43-EGFP construct7 TARDBP GFP...
Showing: 1 - 16 of 16 results