Skip to main content
Addgene

We narrowed to 17 results for: pCAG-GFP

Showing: 1 - 17 of 17 results
  1. Tips for CRISPR Gene Editing in Mice

    Type
    Blog Post
    ... took place and reconstituted the EGFP expression cassette. (b) pCAG-EGxxFP target plasmid and pX330-sgRNA...Mashiko et al. 2013). The pCAG-EGxxFP target plasmid contains overlapping 5′ and 3′ EGFP fragments under the...cloned directionally into the BbsI site. (c) The pCAG-EGxxFP target plasmid was co-transfected with pX330...Once amplified, you can insert this region into a pCAG-EGXXFP plasmid using standard cloning techniques...of transfecting HEK293T cells with your modified pCAG-EGXXFP plasmid along with the individual gRNAs in...Remember the primers you designed to generate your pCAG-EGXXFP plasmid? They are the perfect primer sets...fluorescent protein (EGFP) reconstitution. (a) Scheme of validation for DSB mediated EGFP expression cassette...
  2. New and Upcoming Viral Vectors - September 2019

    Type
    Blog Post
    ...collection is now complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465) are now available...pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE...our entire AAV inventory. Our new AAVs include: EGFP-expressing AAV for serotype testing Calcium sensors... testing AAV, which are small (20 ul) samples of EGFP-expressing AAV packaged in various serotypes. This...interneurons. pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5 and 112677-AAVrg): The EF1a promoter...mCherry in the absence of Cre, and expresses nuclear EGFP in the presence of Cre. Biosensor AAV (calcium ...26976-AAV5) pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5) Calcium Sensors pGP-AAV-syn-jGCaMP7b-WPRE...
  3. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    ...collection! Plasmid Serotype Name 51502 AAV5 pCAG-FLEX-EGFP-WPRE 114471 AAV1, AAV5 pAAV-Ef1a-fDIO mCherry...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP   Biosensor AAV...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Recombinases Plasmid Serotype...
  4. Retrovirus Plasmids

    Type
    Collection
    ...MSCV-IRES-GFP MSCV For transgene expression and GFP marker Reya 21654 pMSCV PIG (Puro IRES GFP empty plasmid...35617 pCAG-Eco Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG ...Weinberg 10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression; also expresses GFP. See pMKO.1 puro.... Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in mammalian...with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression...Plasmid for transgene expression; also expresses GFP. Also see pMIG-w , a variant that has WRE, a post-transcriptional...of dsRed and the activation of your gene fused to eGFP expression Clevers 18760 MSCV IRES Luciferase MSCV...
  5. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...dim GFPs The availability of the three dimensional structure of GFP, its brighter mutant S65T-GFP, and...and GFP shRNA. Mice carrying the R26DsRedR; CRUSH-GFP; and Nestin-Cre alleles showed efficient GFP knockdown...sequence in between two fragments of EGFP in pCAG-EGxxFP. The EGFP fragments contain 482bp of overlapping...identified a family of GFP proteins in the cephalochordate Branchiostoma floridae, named bfloGFPs. They went on...and demonstrate that they can successfully create GFP fusion proteins with a variety of genes across the...enabled scientists to engineer a wide variety of GFPs with diversity in fluorescence brightness, intensity...Cas9 gene editing. Dr. Masahito Ikawa has created a GFP reporter plasmid for scientists to validate the efficacy...
  6. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-1-PV2527 99039-AAV1 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics...pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics Ed Boyden AV-5-PV3446 59170-AAV5 pAAV-Syn-Chronos-GFP Optogenetics...pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics Ed Boyden AV-8-PV3638 65014-AAV8 pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-9-PV2527 99039-AAV9 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics...PV2432 22222-AAV5 AAV-FLEX-Arch-GFP Ed Boyden AV-1-ALL864 51503-AAV1 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-5-PV2509 29777-AAV5 pAAV-CAG-ArchT-GFP Ed Boyden AV...29777-AAV9 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV3446 59170-AAV9 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3511 ...
  7. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...Expression pRSETA-PAGFP - Bacterial Expression tandem PA-GFP-KanR - Yeast Expression pFA6a-PA-GFP-kanMX6 - Yeast...Expression pFA6a-link-yEPAGFP-CaUra3 - Yeast Expression mPA-GFP-N1 - Mammalian Expression mPA-GFP-C1 - Mammalian...then scientists have engineered numerous GFP-variants and non-GFP proteins that result in a diverse set ...tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial expression Davidson Lab Plasmids...Mammalian Expression PA-GFP 504 517 14 Monomer (A206K) pPAGFP-N1 - Mammalian Expression pPAGFP-C1 - Mammalian ...with mCherry, Cerulean, Citrine, and eGFP pPD95_75 - C-terminal GFP for C. elegans expression pHT101-mCherry...
  8. Sequencing Primers

    Type
    Guide
    ...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...BamHI, reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...
  9. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...pCS2TAL3-RR Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination series, pCAG-Golden-Gate-Esp3I-Destination..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ... of DsRed connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The...pCAG-Golden-Gate-Esp3I-Destination Takashi Yamamoto pcDNA-TAL-NC2, pCAGGS-TAL-NC2 Charles Gersbach pcDNA3.1-GoldenGate, pcDNA3.1...
  10. Lentivirus Plasmids

    Type
    Collection
    ...35617 pCAG-Eco N/A Envelope Ecotropic MLV expressing envelope plasmid Nienhuis and Salmon 35616 pCAG-VSVG...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...14748 pLKO.3G 3rd U6-driven shRNA empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. ...
  11. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... Gerlich 25999 LV-GFP Chromatin H2B GFP Elaine Fuchs 11680 H2B-GFP Chromatin H2B GFP Geoff Wahl 21210 ...61803 GFP-Rab7A Late endosomes Rab7a AcGFP Gia Voeltz 12605 GFP-rab7 WT Late endosomes RAB7 GFP Richard...Palmitoylation GFP Connie Cepko 14757 pCAG-mGFP Membrane Palmitoylation sequence from GAP43 EGFP Connie Cepko...Gadella 50057 pLYS1-FLAG-MitoGFP-HA Mitochondria MCU GFP Vamsi Mootha 49153 GFP-Mff Mitochondria-Outer ...89472 GFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 GFP Ken-Ichi Takemaru 89770 pLenti-EGFP-hChibby1...Filaments beta-actin EGFP Robert Singer 27382 pDEST/N1-hEB1-GFP Microtubules EB1 GFP Robin Shaw 40908 pDEST...Beta-catenin GFP Adherens Junctions Beta-catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens...
  12. Control AAV Preps

    Type
    Collection
    ...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive...Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 6, 8, 9, 11, rg*, PHPeB...*, PHP.eB, PHP.S Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB ...83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell... 5, 8, 9, rg* Deisseroth 122100 pAAV-EF1α1.1-GFP EF1a GFP Constitutive 2 Boyden 128434 pAAV-Ef1a-fDIO-... AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8, 9, rg* Zeng 59331 pAAV-CAG-FLEX-EGFP CAG EGFP...PHP.eB Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory EGFP Constitutive 1, 9, PHP.eB Dimidschstein...
  13. Tetracycline Inducible Expression

    Type
    Collection
    ...Iwasato 63704 pRetroX GFP T2A Cre Retroviral vector for dox-inducible expression of GFP T2A Cre recombinase...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS...with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON-3G Mammalian expression of the Tet-On 3G transactivator...viral tTA plasmids. tTA Viviana Gradinaru 104102 pCAG-tTA Mammalian expression of tTA from the CAG promoter...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...
  14. Retrograde AAV viral preps

    Type
    Collection
    ... pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control Fishell... PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control...pAAV-Syn-ChR2(H134R)-GFP Syn Activator Optogenetics Boyden 59170 pAAV-Syn-Chronos-GFP Syn Activator Optogenetics...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Inhibitor Optogenetics Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG Inhibitor...Recombinases Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP-tagged Cre expression Recombinases...Cre-dependent Optogenetics Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CamKII Inhibitor Optogenetics Boyden 105669...Zeng 50465 pAAV-hSyn-EGFP Syn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP CamKII EGFP Control Roth 114472...
  15. Arf GTPase Family

    Type
    Collection
    ...Mammalian (pEGFP-N3), Gateway GEF Arfgef1 (BIG1, ARFGEP1) 10565 1849 Mammalian (pcDNA4c, pCAG), Gateway...Gateway GEF Arfgef2 (BIG2) 10564 1785 Mammalian (pCAG), Gateway GEF Arfgef3 (BIG3) 57221 2177 GEF Iqsec1 (BRAG2...EFA6) 5662 1024 Mammalian (pEGFP-C1) GEF Psd2 (EFA6C) 84249 771 Mammalian (pEGFP-C1), Gateway GEF Psd3 (EFA6D...GTPase Arl1 400 181 Bacterial (pET), Mammalian (pEGFP-N3) Gateway GTPase Arl2 402 184 Bacterial (pET),...116984 1704 GAP Arap3 (CENTD3) 64411 1544 Mammalian (pEGFP-C2) GAP Acap1 (CENTB1) 9744 740 Mammalian (pFLAG-CMV2...Bacterial (pET) GAP Git1 28964 770 Mammalian (pcDNA3, pEGFP) GAP Git2 (PKL, CAT2) 9815 759 GAP ELMOD1 55531 ...398 Gateway GEF Cyth2 (ARNO) 9266 400 Mammalian (pEGFP-C1), Gateway GEF Cyth3 (ARNO3, GRP1) 9265 399 Gateway...
  16. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Cpf1 Kim pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...pyogenes Zhang pL-CRISPR.EFS.GFP 57818 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro...pyogenes Zhang pLKO5.sgRNA.EFS.GFP 57822 Mammalian/Lentiviral BsmBI none S. pyogenes EGFP Ebert pSECC 60820...tagRFP657 Ebert pL-CRISPR.SFFV.GFP 57827 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO5.sgRNA.EFS.tRFP...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...
  17. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
Showing: 1 - 17 of 17 results