We narrowed to 5 results for: pbabe puro

...negative control, and empty backbones such as pBABE-puro for retroviral expression and pLVTHM, a lentiviral...empty backbones for shRNA expression, such as pLKO.1 puro and pLKO.1 – TRC cloning vector. Lentiviral Plasmids...

...pMSCV PIG (Puro IRES GFP empty plasmid) MSCV For cloning and gene expression. Select with puromycin or screen...have inserts. ID Plasmid 5'LTR Description PI 1780 pBABE-neo largeTcDNA MoMLV Expression of Large T antigen...additional resistance variants. Bob Weinberg 1773 pBABE-hygro-hTERT MoMLV Expression of hTERT for creation...47916 pRXTN CMV/MSV A modified version of pRX-tight Puro encoding NAT instead of PAC. James Iglehart 20672...GFP. David Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression plasmid. Deletion...creation of immortalized cells. See plasmid 1771 for puromycin selection, and plasmid 1774 for neomycin selection...expression with GFP expression. See plasmid 8452 for puromycin resistance. William Hahn 63704 pRetroX GFP T2A...

...Massague 58261 pBabe-FLAG-Neuroserpin SERPINI1 Flag Dementia Joan Massague 58262 pBabe-Puro-FLAG-Neuroserpin... Bjorkman 11503 pBabe neo human Frataxin FXN Friedreich ataxia Ronald Kahn 11504 pBabe hygro human Frataxin...Frataxin FXN Friedreich ataxia Ronald Kahn 11505 pBabe puro human Frataxin FXN Friedreich ataxia Ronald Kahn...Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan Massague 58260 pBabe-Neuroserpin oloop SERPINI1...Huda Zoghbi 92203 pBABE-delta-Syn-nYFP SNCA YFP CMV Parkinson's Huda Zoghbi 92204 pBABE-Tau-nYFP MAPT YFP...115182 pLD-puro-Cc-PARK7WT-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115183 pLD-puro-Cc-PARK7V51G-VA... pLD-puro-Cc-PARK7C53A-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115185 pLD-puro-Cc-PARK7H126A-VA...

...Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse pBABE 5' CTTTATCCAGCCCTCAC...pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT...cell virus Reverse pBABE 5' CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD...CTTTATCCAGCCCTCAC Psi packaging signal, 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC...GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus...

...pMSCV-pBabeMCS-IRES-RFP IRES Retroviral pMSCV-IRES-YFP II IRES Retroviral pCMMP-MCS-IRES-Puro IRES ...