We narrowed to 5 results for: pbluescript

1. Plasmids 101: Origin of Replication

   Type

   Blog Post

   ...p15A B Relaxed pSC101 ~5 pSC101 C Stringent pBluescript ~300-500 ColE1 (derivative) and F1** A Relaxed...

2. Plasmids 101: Blue-white Screening

   Type

   Blog Post

   ...α-complementation cloning MCS): pGEM-T, pUC18 and pUC19, and pBluescript are a few common vectors. Blue-white screening...

3. Tips for CRISPR Gene Editing in Mice

   Type

   Blog Post

   ... mice, you can clone the PCR products into a pBluescript cloning vector and sequence the resulting plasmid...

4. Sequencing Primers

   Type

   Guide

   ...promoter Reverse pBluescript KS TCGAGGTCGACGGTATC For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC...TCGAGGTCGACGGTATC For pBluescript vector Forward pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector Reverse...TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors...

5. 28 Hot Plasmid Technologies from 2015

   Type

   Blog Post

   ...tools yourself! The tags can be found in the pBluescript II SK+ vector here. For more information on inntags...