We narrowed to 5 results for: pmx retroviral vectors

...leukemia virus (MMLV)-derived retroviruses. Retroviral vectors, such as pMXs or pMSCV, infect dividing cells...safety required for translational use. Viral Vectors Retroviral: Some of the first iPSCs were generated ...corresponding endogenous pluripotency genes. Retroviral vectors are prone to incomplete silencing of reprogramming...cloning capacity (8-10 kb) than other retroviral vectors. This makes it possible to use a polycistronic...reprogramming vectors available from Addgene. Another drawback is that lentiviral vectors insert in different...Cre-lox lentiviral vectors: This approach is the same as using a standard lentiviral vector, but transient...Non-integrating iPSC delivery methods Viral Vectors Adenovirus: Adenoviral vectors infect dividing and nondividing...

... gamma-retroviral transfer, packaging, and envelope plasmids. Read our Gamma-retroviral Vector Guide for...about gamma-retroviral components, viral production, and viral safety. Gamma-Retroviral Vector Guide Popular...Additional Resources Gamma-Retroviral Vector Guide All Viral Plasmids Viral Vectors 101 eBook Biosafety Resource...types. Wild-type gamma-retroviruses have been engineered into gamma-retroviral vectors for safe use in the... Viral Plasmids Gamma-Retroviral Plasmids Gamma-Retroviral Plasmids Transfer Plasmids Packaging ...Popular Gamma-Retroviral Transfer Plasmids Want a retroviral plasmid with your gene of interest? Search...Learn about retroviral plasmids at Addgene, including popular packaging, envelope, and transfer plasmids...

...inserts in pBMN retroviral vector MMLV sequence, for inserts in pBMN retroviral vector Forward pBR322ori-F...intron Forward pMX-S1811 GACGGCATCGCAGCTTGGATACAC MMLV sequence, 5' of MCS in pMXs vector Forward Polyhedrin... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

...Expression (this is a bicistronic vector rather than a fusion protein vector) ZsGreen1-N1 - Mammalian Expression...pcDNA3-mRFP - Mammalian Expression pMXs-mRFP1 - Mammalian Retroviral Expression mCherry 587 610 16 4.5 ...Mammalian Gateway Destination Vector pENTR4-HaloTag (w876-1) - Gateway Entry Vector pCS2+/C-Halo , pCS2+/N-Halo...Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus Expression pSNAP-tag (T7) Vector - Bacterial...pCLIP-tag (m) Vector - Mammalian Expression pENTR4-CLIPf (w877-2) - Gateway Entry Vector pET51b-His-TEV-CLIP-tag...or search our complete collection and filter by vector type, popularity, and more. Blue/UV Protein Excitation...93 5.7 10 min Monomer pCS2+mNeonGreen-C Cloning Vector - Mammalian Expression Return to top Yellow Protein...

...237005 VCP-HaloTag Vector VCP Halo CMV ALS Promega Corporation 237006 HaloTag-VCP Vector VCP Halo CMV ALS...HiBiT-TREM2 Vector TREM2 HiBiT CMV Alzheimer's Promega Corporation 238681 NanoLuc-TREM2 Vector TREM2 NanoLuc...HaloTag-TREM2 Vector TREM2 HaloTag CMV Alzheimer's Promega Corporation 238706 NanoBRET Assay Vector, CSF1R-NanoLuc...PINK1-SmBiT Vector PINK1 SmBiT CMV Parkinson's Promega Corporation 238783 PINK1-LgBiT Vector PINK1 LgBiT...LgBiT-TREM2 Vector TREM2 LgBiT CMV Alzheimer's Promega Corporation 238801 TREM2-SmBiT Vector TREM2 SmBiT...LgBiT Vector TREM2 LgBiT CMV Alzheimer's Promega Corporation 238850 EIF2AK2-NanoLuc Fusion Vector EIF2AK2...Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 polH GAL...