We narrowed to 5 results for: pmxs vectors

...(MMLV)-derived retroviruses. Retroviral vectors, such as pMXs or pMSCV, infect dividing cells, and have...so either a single polycistronic vector or multiple single-gene vectors can be used to package reprogramming...reprogramming vectors available from Addgene. Another drawback is that lentiviral vectors insert in different...Cre-lox lentiviral vectors: This approach is the same as using a standard lentiviral vector, but transient...Non-integrating iPSC delivery methods Viral Vectors Adenovirus: Adenoviral vectors infect dividing and nondividing...reprogramming factors: Mouse Expression Vectors Human Expression Vectors Carey et al Hockemeyer et al Brambrink...Excisible Medium Medium Generates transgene-free and vector-free cells Genome integration Need to sequence...

... Resources Gamma-Retroviral Vector Guide All Viral Plasmids Viral Vectors 101 eBook Biosafety Resource...gamma-retroviruses have been engineered into gamma-retroviral vectors for safe use in the lab. The gamma-retrovirus components...and envelope plasmids. Read our Gamma-retroviral Vector Guide for more information about gamma-retroviral... production, and viral safety. Gamma-Retroviral Vector Guide Popular Gamma-Retroviral Transfer Plasmids... luciferase in mammalian cells. Alice Wong 83356 pMXs-3XHA-EGFP-OMP25 MoMSV For tagging mitochondria with...

...intron Forward pMX-S1811 GACGGCATCGCAGCTTGGATACAC MMLV sequence, 5' of MCS in pMXs vector Forward Polyhedrin... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

...Expression (this is a bicistronic vector rather than a fusion protein vector) ZsGreen1-N1 - Mammalian Expression...Mammalian Gateway Destination Vector pENTR4-HaloTag (w876-1) - Gateway Entry Vector pCS2+/C-Halo , pCS2+/N-Halo...Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus Expression pSNAP-tag (T7) Vector - Bacterial...pCLIP-tag (m) Vector - Mammalian Expression pENTR4-CLIPf (w877-2) - Gateway Entry Vector pET51b-His-TEV-CLIP-tag...or search our complete collection and filter by vector type, popularity, and more. Blue/UV Protein Excitation...93 5.7 10 min Monomer pCS2+mNeonGreen-C Cloning Vector - Mammalian Expression Return to top Yellow Protein...Xenopus/Worm/Sea urchin pET mCitrine LIC cloning vector (u-mCitrine) - Bacterial Expression mCitrine-pBAD...

...237005 VCP-HaloTag Vector VCP Halo CMV ALS Promega Corporation 237006 HaloTag-VCP Vector VCP Halo CMV ALS...pLJM60-Tia1 TIA1 Flag CMV ALS David Sabatini 38248 pMXs-IP HA-Parkin PRKN HA Parkinson's Noboru Mizushima...CMV Spinal muscular atrophy Elliot Androphy 72873 PMXS-SLC1A3 SLC1A3 Episodic ataxia David Sabatini 74156...pHR-HNRNPA1C-mCh-Cry2WT HNRNPA1 SFFV ALS Clifford Brangwynne 101792 pMXs-mPKR-FLAG-IG EIF2AK2 Flag LTR VWM disease Seiichi...19 James Trimmer 129409 Slc1a3-CreERT2 Targeting Vector SLC1A3 PGK Episodic ataxia Walker Jackson 129410...ALS Promega Corporation 237148 NanoBRET Assay Vector, TREM2-HaloTag TREM2 Halo CMV Alzheimer's Promega ...Corporation 237172 EIF2AK2(252-551)-NanoLuc Fusion Vector EIF2AK2 NanoLuc CMV VWM disease Promega Corporation...