Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 1 - 5 of 5 results
  1. Tips for Writing a Good Cover Letter

    Blog Post
    Nov. 5, 2019, 3:21 p.m.
    ...speaker on career issues worldwide and founder of CareerTrax Inc says: “Let's face it, cover letters are ...
  2. Sequencing Primers

    ...primer Ubx-F AACTCGTACTTTGAACAGGC Drosophila Ultrabithorax gene, forward primer V5 Reverse ACCGAGGAGAGGGTTAGGGAT...
Showing: 1 - 5 of 5 results