We narrowed to 8 results for: rax
-
TypeBlog Post...works with medicinal plants such as Launaea taraxacifolia (Willd), an annual herb of Western Tropical ...Aside from their use as food, infusions of L. taraxacifolia leaves are widely used to treat several diseases...
-
Quick Guide to Working with Drosophila Part 1: Getting Started with Flies
TypeBlog Post...that causes the hairs on the dorsal side of its thorax to look like stubble (sb). For a better reference... -
Plasmids 101: Broad Host Range Plasmids
TypeBlog Post... K. pneumoniae, Methylophilus methylotrophus, Moraxella spp., Mycobacterium aurum, M. smegmatis, Paracoccus... -
Antibodies 101: Introduction to Gating in Flow Cytometry
TypeBlog Post...the theoretical background. Let’s dive into the praxis of gating strategies. As an example, we’ll use ... -
A Needle in a Base-Stack: Cas9 Structural Biology
TypeBlog Post...Molecular graphics and analyses performed with UCSF ChimeraX, developed by the Resource for Biocomputing, Visualization... -
Microbiology Resources
TypeCollection...by Microbe System Plasmids for Archaea Species Haloferax sp. Methanococcus maripaludis Methanothermobacter... -
Immunology Research Plasmids and Resources
TypeCollection...(granulocyte-macrophage) CD116, CDw116, CSF2R, CSF2RAX, CSF2RAY, CSF2RX, CSF2RY, GM-CSF-R-alpha, GMCSFR... -
Sequencing Primers
TypeGuide...primer Ubx-F AACTCGTACTTTGAACAGGC Drosophila Ultrabithorax gene, forward primer V5 Reverse ACCGAGGAGAGGGTTAGGGAT...