Skip to main content

We narrowed to 9 results for: renilla luciferase

Showing: 1 - 9 of 9 results
  1. Luminescent Imaging with Nano-lanterns

    Type
    Blog Post
    ...Nano-lanterns contain a Renilla luciferase variant fused to an FP; when supplied with a luciferase substrate, the... problems of low luminescence By itself, Renilla luciferase has a low quantum yield, and when transiently...first Nano-lantern, a fusion of a mutagenized Renilla luciferase (RLuc8) with Venus. This luminescent technology...energy transfer (BRET). Photons emitted by a Renilla luciferase variant are used to excite the fused fluorescent...the luciferase transfers energy to the FP, resulting in a fluorescent signal. Since their first publication...need for an excitation light source. Instead, a luciferase substrate like coelenterazine is supplied in ...eNL constructs use the brightest characterized luciferase, NanoLuc, and its substrate furimazine. In addition...
  2. Fluorescent Proteins 101: Luciferases

    Type
    Blog Post
    ...Well-established Natural and engineered luciferases Although firefly luciferase was the first bioluminescent reporter...remains popular, other luciferases have been identified in the sea pansy (Renilla reniformis), click beetle...have engineered a variety of improved luciferases. NanoLuc® Luciferase is the best known: it’s derived from...Oplophorus gracilirostris) luciferase and engineered to be extra bright. Other luciferases have been modified ...mammalian systems. Our luciferase collection page has a detailed list of luciferase options. Table 2: Properties...ATP No Luciferase reporter assays for monitoring gene regulation Since firefly luciferase was first...element is cloned upstream of the luciferase gene, and expression of luciferase is measured via the light produced...
  3. Technologies Enabled by NanoLuc® Luciferase

    Type
    Blog Post
    ...than our more common luciferases like firefly (FLuc) and Renilla (RLuc) luciferase. This is important not...coupled luciferase. This strategy was first applied using RLuc8, an engineered Renilla luciferase, to produce...codon-optimized Firefly luciferase genes (e.g., luc2), and NanoLuc® Luciferase are available from the ... creation of NanoLuc® Luciferase from a rather dull 19kDa Oplophorus luciferase by Promega’s Advanced ...isn’t science better when we share? NanoLuc® Luciferase-based tools are fantastic examples of technologies...bioluminescence to overcome these issues as traditional luciferases emit at near optimal wavelengths (Fluc emits ...sources. Unfortunately, detecting traditional luciferases’ dim light emissions requires long acquisition...
  4. Using Ultrasound to Image Bacteria in vivo: Acoustic Reporter Genes

    Type
    Blog Post
    ...Administration of Substrate: Some luciferase reporters, such as Renilla luciferase (RLuc) or NanoLuc, require...bacterial reporters that use fluorophores and luciferases to track bacteria in real time, but each of these...Blog Learn more about in vivo imaging tools The luciferase reporter gene The green fluorescent protein reporter...vivo imaging with fluorescent proteins Browse luciferase plasmids Find fluorescent protein biosensors ...
  5. Luciferase Plasmid Collection

    Type
    Collection
    ...118016 pLX313-Renilla luciferase Renilla EF1α Lentiviral expression of Renilla luciferase William Hahn,... of luciferase found in Addgene's collection include: Firefly luciferase (Fluc) Renilla luciferase (Rluc...101139 pCMV-IRES-Renilla Luciferase-IRES-Gateway-Firefly Luciferase (pIRIGF) Firefly, Renilla Creating ORF-Firefly... Firefly, Renilla Creating ORF-Firefly luciferase gene fusions in plants. Renilla luciferase under the...Firefly, Renilla Insertion of 3' UTR sequences downstream of Renilla luciferase. Firefly luciferase expression...pAAV-CAG-RLuc Renilla CAG AAV expression of Renilla luciferase Mark Kay 83280 pscAAV-CAG-RLuc Renilla CAG Vector...respectively), Cypridina luciferase , and Luciola luciferase . Each type of luciferase has advantages and disadvantages...
  6. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...insensitivity to other ions In BRET, A mutant Renilla luciferase, catalyzes the oxidation of its substrate...transfer (BRET), whereby photons emitted by a Renilla luciferase variant are used to excite a fused fluorescent...culture media as a chemical substrate for Renilla luciferase. This approach is especially suited to complement...alternative to the widely used luciferase reporter gene plasmid pGL3 pGL3 luciferase reporter gene plasmids... issues with fluorescent pH sensors, a set of luciferase-fluorophore pH fusion reporters, pRSETb-pHlash...containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be combined with...gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral vector containing...
  7. Zhang Lab CRISPR Page

    Type
    Collection
    ...to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone with luciferase-2A-Cre recombinase...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and sgRNAs targeting the...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA targeted ...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA backbone ...sgRNAs targeting KRAS , p53 , and LKB1 , plus luciferase-2A-Cre recombinase, and Kras G12D HDR template...
  8. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...with Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly luciferase. The bait and...immunoprecipitated from the cells using the Protein A tag. The luciferase activities can then be measured and normalized... assess interactions. Higher relative firefly luciferase activity in the Co-IP compared of a control Co-IP...
  9. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Forward Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5'...
Showing: 1 - 9 of 9 results