We narrowed to 9 results for: renilla luciferase

...Nano-lanterns contain a Renilla luciferase variant fused to an FP; when supplied with a luciferase substrate, the...Fluorescent imaging techniques have become indispensable tools for molecular and cell biologists over the...the luciferase transfers energy to the FP, resulting in a fluorescent signal. Since their first publication... problems of low luminescence By itself, Renilla luciferase has a low quantum yield, and when transiently...first Nano-lantern, a fusion of a mutagenized Renilla luciferase (RLuc8) with Venus. This luminescent technology...energy transfer (BRET). Photons emitted by a Renilla luciferase variant are used to excite the fused fluorescent...need for an excitation light source. Instead, a luciferase substrate like coelenterazine is supplied in ...

... of luciferase found in Addgene's collection include: Firefly luciferase (Fluc) Renilla luciferase (Rluc...respectively), Cypridina luciferase , and Luciola luciferase . Each type of luciferase has advantages and disadvantages...101139 pCMV-IRES-Renilla Luciferase-IRES-Gateway-Firefly Luciferase (pIRIGF) Firefly, Renilla Creating ORF-Firefly... Firefly, Renilla Creating ORF-Firefly luciferase gene fusions in plants. Renilla luciferase under the...Firefly, Renilla Insertion of 3' UTR sequences downstream of Renilla luciferase. Firefly luciferase expression...118016 pLX313-Renilla luciferase Renilla EF1α Lentiviral expression of Renilla luciferase William Hahn,...pAAV-CAG-RLuc Renilla CAG AAV expression of Renilla luciferase Mark Kay 83280 pscAAV-CAG-RLuc Renilla CAG Vector...

...codon-optimized Firefly luciferase genes (e.g., luc2), and NanoLuc® Luciferase are available from the ... creation of NanoLuc® Luciferase from a rather dull 19kDa Oplophorus luciferase by Promega’s Advanced ...than our more common luciferases like firefly (FLuc) and Renilla (RLuc) luciferase. This is important not...coupled luciferase. This strategy was first applied using RLuc8, an engineered Renilla luciferase, to produce...This post was contributed by Kyle Hooper at Promega. Researchers have been sharing plasmids ever since...isn’t science better when we share? NanoLuc® Luciferase-based tools are fantastic examples of technologies...bioluminescence to overcome these issues as traditional luciferases emit at near optimal wavelengths (Fluc emits ...

...Administration of Substrate: Some luciferase reporters, such as Renilla luciferase (RLuc) or NanoLuc, require...bacterial reporters that use fluorophores and luciferases to track bacteria in real time, but each of these...Blog Learn more about in vivo imaging tools The luciferase reporter gene The green fluorescent protein reporter...vivo imaging with fluorescent proteins Browse luciferase plasmids Find fluorescent protein biosensors ...

...Well-established Natural and engineered luciferases Although firefly luciferase was the first bioluminescent reporter...remains popular, other luciferases have been identified in the sea pansy (Renilla reniformis), click beetle...have engineered a variety of improved luciferases. NanoLuc® Luciferase is the best known: it’s derived from...Oplophorus gracilirostris) luciferase and engineered to be extra bright. Other luciferases have been modified ...mammalian systems. Our luciferase collection page has a detailed list of luciferase options. Table 2: Properties...ATP No Luciferase reporter assays for monitoring gene regulation Since firefly luciferase was first...element is cloned upstream of the luciferase gene, and expression of luciferase is measured via the light produced...

...alternative to the widely used luciferase reporter gene plasmid pGL3 pGL3 luciferase reporter gene plasmids... issues with fluorescent pH sensors, a set of luciferase-fluorophore pH fusion reporters, pRSETb-pHlash...insensitivity to other ions In BRET, A mutant Renilla luciferase, catalyzes the oxidation of its substrate...containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be combined with...gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral vector containing...et al. Nat Methods. 2011. High-throughput luciferase reporter system for detection of pre-mRNA splicing...Gideon Dreyfuss lab has developed rapid-response luciferase (firefly P. pyralis) reporter plasmids for use...

...to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone with luciferase-2A-Cre recombinase...sgRNAs targeting KRAS , p53 , and LKB1 , plus luciferase-2A-Cre recombinase, and Kras G12D HDR template...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and sgRNAs targeting the...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA targeted ...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA backbone ...

...with Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly luciferase. The bait and...immunoprecipitated from the cells using the Protein A tag. The luciferase activities can then be measured and normalized... assess interactions. Higher relative firefly luciferase activity in the Co-IP compared of a control Co-IP...

...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Forward Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5'...