Skip to main content
Addgene

We narrowed to 9 results for: scramble

Showing: 1 - 9 of 9 results
  1. 15 Years of Addgene: The Top 15 Plasmids

    Type
    Blog Post
    ... lentiviral vector that contains a scrambled shRNA. This scrambled shRNA is used as a negative control...envelope expressing plasmid pMD2.G. Find pMDLg/pRPE. scramble shRNA - This plasmid from David Sabatini’s lab...control for mammalian RNAi experiments.  Find the scrambled shRNA vector. pLKO.1 - TRC cloning vector - This...
  2. A Practical Guide to Optimizing AAV DIO and FLEx Vector Expression

    Type
    Blog Post
    ...expression. To test their hypothesis, they randomly scrambled one pair of lox sites and either used the same...transgene (homologous pairs) or used different scrambled sequences to flank the transgenes (non-homologous...amplification. On the left homologous pairs of scrambled cre-recombinase sites lead to greater frequency...leaky expression. On the right non-homologous scrambled recombination sights lead to reduced reversion...
  3. RaPID Detection of RNA-protein Interactions

    Type
    Blog Post
    ...signal (~250-fold enrichment) when compared to a scrambled RNA motif control). BioID2 had no detectable signal...experiments RaPID negative controls include both scrambled RNA motifs and cells transfected with BirA* protein...
  4. Validated gRNA Sequences

    Type
    Collection
    ...AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini scramble synthetic AACCCCTGATTGTATCCGCA 62285 interfere...
Showing: 1 - 9 of 9 results