Skip to main content
Addgene
Showing: 1 - 20 of 20 results

  1. Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens

    Type
    Blog Post
    ...Two-way CRISPR screening In October, Jonathan Weissman’s lab introduced additional pooled CRISPR libraries...transcription start site in those 15,977 human genes. Weissman and his colleagues demonstrated in a paper in ...genome for gene control over a 1,000-fold range. Weissman explained that there are two levels of control...of genes that can be manipulated at one time. Weissman’s group has made standard protocols available and...Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS. Cell. 2014 Oct 23;159(3):647-61. doi: 10.1016...

  2. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ...compact epigenetic silencer By Emily P. Bentley The Weissman and Gilbert Labs have previously deposited their...collaboration with the Vallabh/Minikel Lab, the Weissman Lab has developed a new epigenetic editor, Coupled...C. P., Coffey, A., Howard, M., Kamath, N., … & Weissman, J. S. (2024). Brainwide silencing of prion protein...N., Shi, Q., Hung, K. L., Samelson, A. J., … & Weissman, J. S. (2021). Genome-wide programmable transcriptional...

  3. Mapping the 4D nucleome with CRISPR/Cas9

    Type
    Blog Post
    ...Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Cell. 2013 Dec 19;155(7):1479...fluorescence imaging. Tanenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD. Cell. 2014 Oct 23;159(3):635-46. ...

  4. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Activation Human Weissman 3rd 10 198,810 CRISPRa-v2 83978 1000000091 Activation Human Weissman 3rd 5 10 104,540...Activation Mouse Weissman 3rd 5 10 107,105 214,210 CRISPRi Discontinued Inhibition Human Weissman 3rd 10 206,421... Human Weissman 3rd 5 10 104,535 209,070 CRISPRi-v2 83987 1000000092 Inhibition Mouse Weissman 3rd 5 10...Human Weissman 3rd 5 Varies hCRISPRi-v2 subpooled libraries 83971 — 83977 Inhibition Human Weissman 3rd ...Mouse Weissman 3rd 5 Varies mCRISPRi-v2 subpooled libraries 83989 — 83995 Inhibition Mouse Weissman 3rd ...Non-coding Libraries 86538 — 86550 Inhibition Human Weissman 3rd 10 Varies CRISPR/Cas9-assisted Removal of ...Libraries 187246 — 187248 1000000192 Inhibition Human Weissman 3rd 6 Varies Dual sgRNA CRISPRa Libraries 187249...

  6. CRISPR Activation: A Practical Guide

    Type
    Blog Post
    ...Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS (2014) Genome-Scale CRISPR-Mediated Control...nchembio.1753 Tanenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD (2014) A Protein-Tagging System for...

  8. SunTag and Fluorescent Imaging

    Type
    Blog Post
    ...developing their SunTag technology, the Vale and Weissman labs took this biological lesson and created a...

  9. Qi Lab CRISPR Page

    Type
    Collection
    ...Expression. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA. Cell . 2013 Feb 28;152(5..., Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell . 2013 Jul 9. doi: 10.1016/j.cell...

  10. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. 2013. Dynamic imaging of genomic...Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS. 2014. Genome-Scale CRISPR-Mediated Control..., Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. 2013. CRISPR-mediated modular RNA-guided...

  12. Design Tips for Prime Editing

    Type
    Blog Post
    ...J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu, D. R. (2021). Enhanced...

  13. CRISPR Guide

    Type
    Collection
    ...CRISPRoff , developed by the Luke Gilbert and Jonathan Weissman labs , is an all-in-one dCas9 fusion with KRAB...J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu, D. R. (2021). Enhanced...Zhang, W., Li, G., Park, J., Blackburn, E. H., Weissman, J. S., Qi, L. S., & Huang, B. (2013). Dynamic..., Whitehead, E. H., Doudna, J. A., Lim, W. A., Weissman, J. S., & Qi, L. S. (2013). CRISPR-Mediated modular... L., Bassik, M. C., Qi, L. S., Kampmann, M., & Weissman, J. S. (2014). Genome-Scale CRISPR-Mediated control...Bernstein, B. E., Hovestadt, V., Gilbert, L. A., & Weissman, J. S. (2021). Genome-wide programmable transcriptional... Larson, M. H., Gilbert, L. A., Doudna, J. A., Weissman, J. S., Arkin, A. P., & Lim, W. A. (2013). Repurposing...

  14. CRISPR Guide

    Type
    Guide
    ...CRISPRoff , developed by the Luke Gilbert and Jonathan Weissman labs , is an all-in-one dCas9 fusion with KRAB...J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu, D. R. (2021). Enhanced...Zhang, W., Li, G., Park, J., Blackburn, E. H., Weissman, J. S., Qi, L. S., & Huang, B. (2013). Dynamic..., Whitehead, E. H., Doudna, J. A., Lim, W. A., Weissman, J. S., & Qi, L. S. (2013). CRISPR-Mediated modular... L., Bassik, M. C., Qi, L. S., Kampmann, M., & Weissman, J. S. (2014). Genome-Scale CRISPR-Mediated control...Bernstein, B. E., Hovestadt, V., Gilbert, L. A., & Weissman, J. S. (2021). Genome-wide programmable transcriptional... Larson, M. H., Gilbert, L. A., Doudna, J. A., Weissman, J. S., Arkin, A. P., & Lim, W. A. (2013). Repurposing...

  16. Validated gRNA Sequences

    Type
    Collection
    ...TTGATATTTAAGTTAATAAA 46922 interfere S. pyogenes 23849981 Weissman telomeres H. sapiens GTTAGGGTTAGGGTTAGGGTTA 51024...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate...
Showing: 1 - 20 of 20 results