...Two-way CRISPR screening In October, Jonathan Weissman’s lab introduced additional pooled CRISPR libraries...transcription start site in those 15,977 human genes. Weissman and his colleagues demonstrated in a paper in ...genome for gene control over a 1,000-fold range. Weissman explained that there are two levels of control...of genes that can be manipulated at one time. Weissman’s group has made standard protocols available and...Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS. Cell. 2014 Oct 23;159(3):647-61. doi: 10.1016...

...Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Cell. 2013 Dec 19;155(7):1479...fluorescence imaging. Tanenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD. Cell. 2014 Oct 23;159(3):635-46. ...

...Activation Human Weissman 3rd 10 198,810 CRISPRa-v2 83978 1000000091 Activation Human Weissman 3rd 5 10 104,540...Activation Mouse Weissman 3rd 5 10 107,105 214,210 CRISPRi Discontinued Inhibition Human Weissman 3rd 10 206,421... Human Weissman 3rd 5 10 104,535 209,070 CRISPRi-v2 83987 1000000092 Inhibition Mouse Weissman 3rd 5 10...Human Weissman 3rd 5 Varies hCRISPRi-v2 subpooled libraries 83971 — 83977 Inhibition Human Weissman 3rd ...Mouse Weissman 3rd 5 Varies mCRISPRi-v2 subpooled libraries 83989 — 83995 Inhibition Mouse Weissman 3rd ...

....2600 Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA (2013) Repurposing CRISPR...s41598-019-54179-x Tanenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD (2014) A Protein-Tagging System for...

...Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS (2014) Genome-Scale CRISPR-Mediated Control...nchembio.1753 Tanenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD (2014) A Protein-Tagging System for...

...fluorescent proteins in the nervous system. Livet J, Weissman TA, Kang H, Draft RW, Bennis RA, Sanes JR, Lichtman...lineage analysis in zebrafish. Pan YA, Freundlich T, Weissman TA, Schoppik D, Wang XC, Zimmerman S, Ciruna B...

...developing their SunTag technology, the Vale and Weissman labs took this biological lesson and created a...

...Expression. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA. Cell . 2013 Feb 28;152(5..., Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell . 2013 Jul 9. doi: 10.1016/j.cell...

...Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. 2013. Dynamic imaging of genomic...Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS. 2014. Genome-Scale CRISPR-Mediated Control..., Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. 2013. CRISPR-mediated modular RNA-guided...

...Gilbert LA, Whitehead EH, La Russa M, Tsai JC, Weissman JS, Dueber JE, Qi LS, Lim WA. Cell . 160(1-2):...imaging. 2014. Tanenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD. Cell . 159(3):635-46. PMID: 25307933...Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS. Cell . 159(3):647-6. PMID: 25307932 Improving..., Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell . 154(2):442-51. PMID: 23849981...Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Cell . 155(7):1479-91. PMID...2013. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA. Cell . 152(5):1173-83. PMID...

...0327-z Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA (2013) Repurposing CRISPR...

...Gilbert LA, Whitehead EH, La Russa M, Tsai JC, Weissman JS, Dueber JE, Qi LS, Lim WA. Cell . 160(1-2):...imaging. 2014. Tanenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD. Cell . 159(3):635-46. PMID: 25307933...Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS. Cell . 159(3):647-6. PMID: 25307932 Improving..., Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell . 154(2):442-51. PMID: 23849981...Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Cell . 155(7):1479-91. PMID...2013. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA. Cell . 152(5):1173-83. PMID...

...TTGATATTTAAGTTAATAAA 46922 interfere S. pyogenes 23849981 Weissman telomeres H. sapiens GTTAGGGTTAGGGTTAGGGTTA 51024...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate...

...60955 Mammalian/Lentiviral none S. pyogenes Puro Weissman pLSC-5 62889 Mammalian/Lentiviral BsmBI yes, cut...

...targeted fluorescent molecules. The Vale lab and the Weissman lab have teamed up and advanced technology in ...