We narrowed to 513 results for: gats

... intermediate pluripotent state is not always obligatory in cell conversion processes [35]. Rather than... during the reprogramming process as they are propagated in vitro as part of the process. This opens up...

...fine; a 5% positive error on one side and a 5% negative error on the other will introduce unwanted variation...adapted from Wong, 2018.    🔥Hot Tip🔥 Negative fold changes in ΔΔCT are represented by RQs between...

...digest should discriminate between positive and negative clones. Clones with insertion will show only linearized...Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 plasmid use 30 ...

...new and updated content in a clean and easy-to-navigate design. You can find it, along with other eBooks...

... scientists to use it as a model organism to interrogate many scientific questions. But these tiny creatures...

...publishing research. Addgene’s research team also investigates new strategies to improve viral vector production...

...collaboration with Addgene writers High Complexity Golden Gate Assembly with NEB's DADExperts: Matthew Norton and...

...cytometry expertise in three posts. An Introduction to Gating in Flow Cytometry, Designing Your First Flow Panel...

...! AAV purification by iodixanol gradient ultracentrifugation This video goes over AAV vector purification...

...series.   And if you haven’t seen our webinar “Navigating an Expanding Landscape for Engineered Systemic...

...start the AAV packaged on request process, simply navigate to your plasmid of interest. If it’s eligible ...

...years, in vivo CRISPR screens have been used to interrogate T cells, an important immune cell type, in more...

...  Here at Addgene, we love all data, including negative data, which can help researchers save time and...

... to collaboration and resource sharing, we can navigate this difficult period together. The future of ...

...Zhang was awarded one of this year’s SfN Young Investigator Awards and we couldn’t wait to congratulate ...

...Filovirus, a family characterized by single, linear, negative-sense, single-stranded RNA genomes. The virus ...

...significant hit across the E. coli genome as a negative control. Read the paper in Nature Communications...

...like everyone around the world, are learning to navigate the changes brought about by the pandemic. As ...

...batch of competent cells, don’t forget to do a negative control (plate your cells without adding plasmid...

...ring that glows with a faint green light. To investigate this green glimmer, Shimomura collected many,...