We narrowed to 515 results for: gats

...sites until after RNA loading: the structure to interrogate the sequence isn’t in place yet.     ... Greene, E. C., & Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. ...

... intermediate pluripotent state is not always obligatory in cell conversion processes [35]. Rather than... during the reprogramming process as they are propagated in vitro as part of the process. This opens up...

...fine; a 5% positive error on one side and a 5% negative error on the other will introduce unwanted variation...adapted from Wong, 2018.    🔥Hot Tip🔥 Negative fold changes in ΔΔCT are represented by RQs between...

...digest should discriminate between positive and negative clones. Clones with insertion will show only linearized...Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 plasmid use 30 ...

...new and updated content in a clean and easy-to-navigate design. You can find it, along with other eBooks...

...collaboration with Addgene writers High Complexity Golden Gate Assembly with NEB's DADExperts: Matthew Norton and...

... scientists to use it as a model organism to interrogate many scientific questions. But these tiny creatures...

...publishing research. Addgene’s research team also investigates new strategies to improve viral vector production...

...cytometry expertise in three posts. An Introduction to Gating in Flow Cytometry, Designing Your First Flow Panel...

...! AAV purification by iodixanol gradient ultracentrifugation This video goes over AAV vector purification...

...series.   And if you haven’t seen our webinar “Navigating an Expanding Landscape for Engineered Systemic...

...start the AAV packaged on request process, simply navigate to your plasmid of interest. If it’s eligible ...

...years, in vivo CRISPR screens have been used to interrogate T cells, an important immune cell type, in more...

... to collaboration and resource sharing, we can navigate this difficult period together. The future of ...

...  Here at Addgene, we love all data, including negative data, which can help researchers save time and...

...Zhang was awarded one of this year’s SfN Young Investigator Awards and we couldn’t wait to congratulate ...

...Filovirus, a family characterized by single, linear, negative-sense, single-stranded RNA genomes. The virus ...

...like everyone around the world, are learning to navigate the changes brought about by the pandemic. As ...

...significant hit across the E. coli genome as a negative control. Read the paper in Nature Communications...

...batch of competent cells, don’t forget to do a negative control (plate your cells without adding plasmid...