We narrowed to 15 results for: gats
-
TypeGuide...-NGG PAM sequences include: xCas9 - NG, GAA, and GAT; increase nuclease fidelity SpCas9-NG - NG; increase...VQR variant 3' NGAN or NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG Staphylococcus aureus (SA); SaCas9... used for small precision edits. NHEJ directly ligates the break ends without the need for a homologous...system, CRISPRi is introduced into bacteria using conjugation and stably integrated into the chromosome. Browse...CJ) 3' NNNNRYAC Neisseria meningitidis (NM) 3' NNNNGATT Streptococcus thermophilus (ST) 3' NNAGAAW Treponema...). Unraveling the mechanisms of PAMless DNA interrogation by SpRY-Cas9. Nature Communications , 15 (1)...on the consecutive binding and degradation of negatively supercoiled invader DNA by cascade and CAS3. ...
-
Antibody Guide
TypeGuide...components can interfere with the conjugate or conjugation process. Sodium azide, an antimicrobial agent,... back to buffers after the conjugation reaction is complete. HRP-conjugated antibodies should not be stored...done through a conjugation reaction. Many antibodies can be purchased already conjugated, which can save...you want is not available pre-conjugated, or is not available conjugated to your signaling molecule of...indirect detection method uses an unconjugated primary antibody and a conjugated secondary antibody specific...well plate. A conjugated primary antibody is used to bind to the antigen and the conjugate, typically HRP...indirect sandwich method, a conjugated secondary antibody is added. The conjugate is activated and the output... -
Sequencing Primers
TypeGuide...' end of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' ...pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG (Waugh lab... Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...Forward CGCAACGATCTGGTAAACAC (Invitrogen) OpIE2 promoter, forward primer pACYC-F TGAAGTCAGCCCCATACGAT p15A...vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC MMLV sequence, for...Forward TCAAGCCTCAGACAGTGGTTC (Invitrogen) Human elongation factor-1a promoter, forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG... -
Cloning
TypeGuide...Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid 101: Gateway Cloning ) Gateway...Plasmid 101: Golden Gate Cloning ) Back to Top Ligation Independent Cloning Ligation Independent Cloning...Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning Oligo Stitching... Gateway® cloning is a recombination based cloning method. The benefit of Gateway® is that moving a piece...cassettes). Although gateway cloning is a simple and efficient cloning method, gateway vectors and recombination...degrade over time, further reducing ligation efficiency. TOPO® ready Gateway® Entry plasmids are also available...Type IIS Assembly (Golden Gate & MoClo) Type IIS systems, such as Golden Gate and Modular Cloning (MoClo... -
Guide to Using Pooled Libraries
TypeGuide...winners’. Negative Screen Negative screens are a little trickier than positive screens. In a negative screen...false positives or false negatives in later experiments, and can also negatively affect data reproducibility...random chance that could lead to false positive or negative results - for a given plasmid, think of each cell...be divided into two types: positive screens and negative screens. Both types of screen employ a selection...pooled library to cells. DIVERGE: Positive and negative screens POSITIVE screen: Apply library Apply selection... Get a list of genes involved in the selection NEGATIVE screen: Apply library Perform Next Generation ...been depleted by selection. In a CRISPR screen, negative screens are often used to identify genes that ... -
Molecular Biology Reference
TypeGuide...experiment. E. coli strains for propagating plasmids E. coli are gram-negative, rod shaped bacteria naturally...Introduction Types of Plasmids E. coli strains for propagating plasmids Antibiotics commonly used for plasmid...another by a type of horizontal gene transfer (conjugation), usually providing a benefit to the host, such... E. coli , it is replicated independently and segregated to the resulting daughter cells. These daughter...recognition site. These elements allow for the propagation of the plasmid within bacteria, while allowing...bacteria with plasmids, thus selecting against the propagation of these plasmids through cell division. To ensure...insertion of DNA by restriction enzymes digestion and ligation. In expression plasmids, the MCS is often located... -
Optogenetics Guide
TypeGuide... Collection . Microbial Opsins Opsins are light-gated ion channels or pumps that absorb light at specific...ChRs. These ChR variants still function as light-gated, cation channels resulting in excitation (depolarization...identified in other species - by acting as light-gated chloride channels, these variants result in the ...plasmids . Halorhodopsins Halorhodopsins are light-gated inward chloride pumps isolated from halobacteria...Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from Chlamydomonas reinhardtii (CrChR2...a transgenic mouse line, such as for example the VGAT-ChR2 mouse, where ChR2 is expressed under the control...vesicular gamma aminobutyric acid (GABA) transporter (VGAT) and ChR2 is thus expressed in all GABAergic neurons... -
Chemogenetics Guide
TypeGuide...using Chemogenetics plasmids in your lab for interrogation of neuronal activity....coupled with an ion pore domain (IPD) to form ligand-gated ion channels (LGICs) that can either excite or inhibit...neuronal activity. Figure 3: PSAM4-based ligand-gated ion channels, their effect, and outcome in neurons...Sternson SM, Roth BL (2014). Chemogenetic tools to interrogate brain functions. Annu Rev Neurosci. 37:378–407...DREADD Facilitates the Multiplexed Chemogenetic Interrogation of Behavior. Neuron. 86:936–46. PMID: 25937170... -
Adeno-associated virus (AAV) Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...Cells AAV Purification by Iodixanol Gradient Ultracentrifugation AAV Titration by ddPCR AAV Titration by qPCR... that enhances DNA replication by stimulating elongation and stabilizing the displaced single-stranded... -
Promoters
TypeGuide...together. Operon regulation can be either negative or positive. Negative repressible operons, are normally bound...Constituitve Strong mammalian promoter from human elongation factor 1 alpha CAG Constitutive Strong hybrid...The Lac operon in bacteria is an example of a negatively controlled operon. A positive repressible operon... -
Gamma-Retroviral Vector Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...gamma-retroviral vector purification by high-speed centrifugation for CAR T cell manufacturing. Molecular Therapy... -
Lentiviral Vector Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant...unwanted side effects. This concern can be partially mitigated through the use of tissue-specific promoters and... -
Plan Your Experiment
TypeGuide...bound to the DNA can interfere with transcription elongation. CRISPR Activation : Target the transcription...containing the gRNA scaffold using standard restriction-ligation cloning. However, the exact cloning strategy will...., Sousa-Luís, R., & Proudfoot, N. J. (2023). Elongation roadblocks mediated by dCas9 across human genes... -
Adenovirus Guide
TypeGuide...including restriction enzyme, Gibson Assembly, or Gateway. Some transfer plasmids may have limited restriction...compatible with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant... -
Science Guides
TypeGuide...Antibody-based applications, which often use antibodies conjugated to a signaling molecule, can be used to capture...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...