We narrowed to 599 results for: REV;
-
TypeBlog PostPublishedOct. 10, 2017, 1:57 p.m....Single Molecule Localization (PALM/STORM), or Reversible Saturable Optical Linear Fluorescence Transitions.... Lens-based fluorescence nanoscopy. Quarterly reviews of biophysics 48, 178-243 (2015). PubMed PMID: ...
-
Delivery Methods for Generating iPSCs
TypeBlog PostPublishedApril 17, 2018, 1:37 p.m.... stem cells: reprogramming à la carte." Nature Reviews Genetics 12, no. 4 (2011): 231-42. PubMed PMID:...reference. 1. Malik, Nasir, and Mahendra S. Rao. "A Review of the Methods for Human iPSC Derivation." Methods... -
CRISPR/Cas9 FAQs Answered!
TypeBlog PostPublishedMarch 13, 2014, 4:08 p.m....primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 ...D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E., Scott, D. A., Inoue, A., Matoba, S., Zhang... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog PostPublishedSept. 28, 2020, noon...expression of a catalytically dead Cas9 enzyme allows reversible repression based on the presence of the inducer...modulation. CRISPRa from sigma-54 promoters Noting that previous work in bacterial CRISPRa had focused on sigma... -
2022 Depositor Week
TypeBlog PostPublishedDec. 12, 2022, 2:15 p.m....depositing their data with us through our newly revamped Data Hub! The community needs more data-sharing... -
Addgene is Stopping Use of X (formerly Twitter)
TypeBlog PostPublishedJan. 11, 2024, 2:15 p.m....away from the functionality and features that previously made the platform a mainstay of conversation ... -
The 12 Days of CRISPR
TypeBlog PostPublishedJan. 3, 2023, 2:15 p.m....Addgene gave to me: Functional Genetic Variants Revealed by Massively Parallel Precise Genome Editing (... -
Trends in CRISPR and SynBio Technologies
TypeBlog PostPublishedFeb. 4, 2015, 3:58 p.m....on CRISPR and synBio plasmid sharing In a recent review on CRISPR technology, for example, the authors ... -
New FLIS Plasmid (April Fools 2022)
TypeBlog PostPublishedApril 1, 2022, 1:15 p.m...., the Phuels lab deposited a plasmid that will forever change the fly lab experience. The Frequency Light... -
Find and Share AAV Data with Addgene's New AAV Data Hub
TypeBlog PostPublishedOct. 8, 2019, 12:33 p.m....promoter, or tool type. Drilling into any entry will reveal additional data including the subject’s age at ...