We narrowed to 27 results for: aav gfp cre

1. University of Florida Serotype Testing Panel for the Eye and Brain

   Type

   Collection

   ...You may also like: Viral Service: All AAV Viviana Gradinaru PHP AAV Serotypes Blog: Viral Vectors As part...actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2(Y444F) When using the AAV2(Y444F) serotype...We provide high quality AAV preps from select plasmids in the repository. Browse the University of Florida... Viral Vector Packaging Service AAV University of Florida Serotype Testing Panel for ...viral vectors undergo quality control, including AAV titration by ddPCR, in vitro and (when possible) ...transduction of the mouse retina by tyrosine-mutant AAV serotype vectors. Mol Ther . 2009 Mar;17(3):463-71...One . Jun 8;10(6). PMID: 26052939 Lu, et al. 2016. AAV-mediated transduction and targeting of retinal bipolar...

2. Neurodegeneration Research Collection

   Type

   Collection

   ... Nat Biotechnol. 2023 May 22. See More AAV Viral Preps Find AAV viral preps for systemic delivery of viral...Noteworthy: AAV.rTH.PI.Cre.SV40 ready-to-use viral prep useful for dopamine research. CBA-driven, Cre-dependent...research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors Antibodies...Oct 18. Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent...Cre-dependent expression of diphtheria toxin receptor (DTR)–GFP fusion protein. Azim et al. Nature. 2014 Apr 17. ...blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons function...antibodies and scFvs for neuroscience research created with high-volume hybridoma sequencing on the NeuroMabSeq...

3. Neurodegeneration Plasmid Collection

   Type

   Collection

   ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...

4. CRISPR Plasmids - Tagging

   Type

   Collection

   ...include Cre and FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting...provide PCR templates for amplification of the tag (eg GFP, Flag, YFP, etc) and selection markers. Two independent..._CEBPA_1 PX458_CEBPA_2 CREB1 Human FLAG pFETCh_CREB1 PX458_CREB_1 PX458_CREB_2 TGIF2 Human FLAG pFETCh_TGIF2...targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG-2xSTREP Construct for integrating at the AAVS1 "safe ... lines were created using CRISPR and the donor plasmids containing homology arms and EGFP are available...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus using untagged SpCas9 ...

5. Validated gRNA Sequences

   Type

   Collection

   ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens...

6. CRISPR Guide

   Type

   Collection

   .... Mammalian CRISPR libraries have also been created in AAV backbones for in vivo experiments and in a ...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...capabilities but are small enough to be packaged in AAV particles. Cas13 fusions have also been used in in... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...

7. Allen Institute for Cell Science Plasmid Collection

   Type

   Collection

   ...envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ATP2A2-mEGFP AICSDP-41 mEGFP SERCA2 Sarcoplasmic...Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin...87422 LMNB1-mEGFP AICSDP-10 mEGFP Lamin B1 Nuclear envelope 87423 TOMM20-mEGFP AICSDP-8 mEGFP Tom20 Mitochondria...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin Actin... SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum 87427 FBL-mEGFP AICSDP-13 mEGFP Fibrillarin...AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm...101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...