We narrowed to 23 results for: tomato
-
TypeCollection...Lentiviral expression of firefly luciferase and dTomato. A gene of interest can also be inserted into the...
-
Validated gRNA Sequences
TypeCollection...ATCACAGTGATGCTCGTCAA cut S. pyogenes 26479191 Kim tdtomato Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Trypanosoma cruzi yes, cut S. pyogenes Neo Docampo tdTomato/pTREX-b 68709 Other/Trypanosoma cruzi none S. ...