Skip to main content
Addgene
Showing: 1 - 11 of 11 results
  1. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... import sequence and COX VIII signal peptide dL5 FAP; mCerulean3 Marcel Bruchez 44385 pLV-mitoGFP Mitochondria...2xG4S-mCer3 Nucleus NLS (from Mak16p protein) dL5 FAP; mCerulean3 Marcel Bruchez 73207 pcDNA3.1-KozATG-...KozATG-dL5-2XG4S-mCer3 Cytosol, nucleoplasm None dL5 FAP; mCerulean3 Marcel Bruchez 36206 pmTurquoise2-NES ...-TMst Cell surface (mammalian) PDGFR-derived dL5 FAP; mCerulean3 Marcel Bruchez 45944 pTDpelB-C_sfYFPTwinStrep... SKL tripeptide, peroxisome transport signal dL5 FAP; mCerulean3 Marcel Bruchez 85065 pmScarlet-I_peroxisome_C1...-2XG4S-mCer3-KDEL Endoplasmic Reticulum KDEL dL5 FAP; mCerulean3 Marcel Bruchez 73209 pcDNA3.1-kappa-myc-dL5...-2XG4S-mCer3-KDEL Endoplasmic Reticulum KDEL dL5 FAP; mCerulean3 Marcel Bruchez 85068 pCytERM_mScarlet-i_N1...
  2. Biosensor AAV Preps

    Type
    Collection
    ...pGP-AAV-GFAP-iGABASnFR2-WPRE GFAP iGABASnFR2 none Constitutive 1, 5 GENIE 218873 pGP-AAV-GFAP-iGABASnFR2...Constitutive 1, 5, 9 Looger 98930 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 GFAP iGluSnFr none Constitutive 1, 5,...none Cre dependent 1 Looger 106192 pAAV.GFAP.SF-iGluSnFR.A184S GFAP SF-iGluSnFR.A184S none Constitutive... Sensors GRAB_5-HT Promoter CAG CaMKIIa Dlx EF1a GFAP/GfaABC1D Synapsin E2 regulatory element Activity...pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE GFAP iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218874 pGP-AAV-syn-iGABASnFR2...
  3. Cre-lox system

    Type
    Collection
    ...codon optimized Cre PGK AAV Aebischer 24704 GFAP-Cre Cre GFAP Mammalian Sofroniew 25997 LV-Cre pLKO.1 Cre...CMV Mammalian Hughes 40591 hGFAP-Cre mouse astrocyte expression of Cre hGFAP Mammalian Messing 45359 pNK-TGCK...PGK Retroviral Pandolfi 51263 hGFAP-Roxed-Cre Dre-dependent Roxed-Cre GFAP Mammalian Pelczar 51267 pCAG-Co-InCreN...EGFP-Cre fusion CMV AAV Wilson 105550 pAAV.GFAP.Cre.WPRE.hGH Cre GFAP AAV Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...Bacterial Dunlop 135217 pDEST mfap4:icre-p2a-tomato iCre and tdTomato mfap4 Zebrafish Tobin 135618 pAAV-...
  4. Control AAV Preps

    Type
    Collection
    ...tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato...TurboRFP Constitutive 1, 8 Wilson 105549 pAAV.GFAP.eGFP.WPRE.hGH GFAP EGFP Constitutive 5 Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG... AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin TBG Other Fluorophore/Tag ...
  5. The Pleiades Promoter Project

    Type
    Collection
    ... EGFP/NLS Ple88 GFAP pEMS1375 EGFP/NLS Ple88 GFAP pEMS1559 intron-lacZ/NLS Ple89 GFAP pEMS1376 EGFP/NLS...NLS Ple90 GFAP pEMS1121 EGFP/cre/NLS Ple90 GFAP pEMS1377 EGFP/NLS Ple92 GPR88 pEMS1160 EGFP/NLS Ple93 ...
  6. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Laforin Human Mouse IgG2a 114536 Anti-GFAP R416WT [N206B/9R] GFAP R416WT Human Mouse IgG2a 114538 Anti-...] Frataxin Human Mouse IgG2a 177512 Anti-GFAP [N206A/8R] GFAP Human Mouse IgG2a 177513 Anti-LRP4 (extracellular...-2b] RGS14 Rat Mouse IgG2b 199410 Anti-GFAP [N206A/8R-2b] GFAP Human Mouse IgG2b 199412 Anti-Cav1.2 Ca2...Neurexin-1-Beta Human Mouse IgG1 206703 Anti-GFAP [N206A/8R-1] GFAP Human Mouse IgG1 206705 Anti-Cav1.2 Ca2.../Rat rat IgG2a 225421 GFAP (Homo sapiens) recombinant monoclonal antibody. GFAP Human Chimera: Mouse/Rat...Neurexin-1-Beta Human Mouse 199426 GFAP scFv [N206A/8] N206A/8 scFv GFAP Human Mouse 199428 MAP3K12 scFv ...
  7. Chemogenetics AAV Preps

    Type
    Collection
    ...50478 pAAV-GFAP-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion none 5 Roth 50479 pAAV-GFAP-hM4D(Gi...DREADD PSAM4 GlyR Promoter Synapsin CaMKIIa CD68 Dlx GFAP nEF CAG E2 regulatory element Tag Fusion tags mCherry...Activation NLS-dTomato none 1, 9, rg* Fishell 50472 pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine rM3D(Gs) - Activation ...
  8. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...Douglas Kim AV-1-PV2914 98930-AAV1 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV3080...Douglas Kim AV-5-PV2914 98930-AAV5 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-5-PV3107...Douglas Kim AV-9-PV2914 98930-AAV9 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-9-PV3081... Philip Haydon AV-5-PV2407 105549-AAV5 pAAV.GFAP.eGFP.WPRE.hGH Control James M. Wilson AV-5-PV3106 44332...James M. Wilson AV-5-PV2408 105550-AAV5 pAAV.GFAP.Cre.WPRE.hGH Cre Recombinase James M. Wilson AV-6-PV1090...
  9. Recombinases AAV Preps

    Type
    Collection
    ...pAAV-EF1a-C-CreintG EF1a none 1 Cepko 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson 196410 AAV-GfaABC1D-Cre...
  10. Caltech Systemic Capsids

    Type
    Collection
    ...Cre-EGFP expression Cre Wilson 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP Cre-expression Cre Wilson 107738 pAAV-hSyn-Cre-P2A-dTomato...
  11. Validated gRNA Sequences

    Type
    Collection
    ...TGGTCCGTCTAGAAACTCGGTAC 64159 activate S. pyogenes 25619936 Sato gfap D. rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes...
Showing: 1 - 11 of 11 results