We narrowed to 9 results for: GFAP
-
TypeCollection...50478 pAAV-GFAP-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion none 5 Roth 50479 pAAV-GFAP-hM4D(Gi...DREADD PSAM4 GlyR Promoter Synapsin CaMKIIa CD68 Dlx GFAP nEF CAG E2 regulatory element Tag Fusion tags mCherry...Activation NLS-dTomato none 1, 9, rg* Fishell 50472 pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine rM3D(Gs) - Activation ...
-
Biosensor AAV Preps
TypeCollection...pGP-AAV-GFAP-iGABASnFR2-WPRE GFAP iGABASnFR2 none Constitutive 1, 5 GENIE 218873 pGP-AAV-GFAP-iGABASnFR2...Constitutive 1, 5, 9 Looger 98930 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 GFAP iGluSnFr none Constitutive 1, 5,...none Cre dependent 1 Looger 106192 pAAV.GFAP.SF-iGluSnFR.A184S GFAP SF-iGluSnFR.A184S none Constitutive... Sensors GRAB_5-HT Promoter CAG CaMKIIa Dlx EF1a GFAP/GfaABC1D Synapsin E2 regulatory element Activity...pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE GFAP iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218874 pGP-AAV-syn-iGABASnFR2... -
The Pleiades Promoter Project
TypeCollection... EGFP/NLS Ple88 GFAP pEMS1375 EGFP/NLS Ple88 GFAP pEMS1559 intron-lacZ/NLS Ple89 GFAP pEMS1376 EGFP/NLS...NLS Ple90 GFAP pEMS1121 EGFP/cre/NLS Ple90 GFAP pEMS1377 EGFP/NLS Ple92 GPR88 pEMS1160 EGFP/NLS Ple93 ... -
Control AAV Preps
TypeCollection...TurboRFP Constitutive 1, 8 Wilson 105549 pAAV.GFAP.eGFP.WPRE.hGH GFAP EGFP Constitutive 5 Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG... AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin TBG Other Fluorophore/Tag ...tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato... -
Recombinases AAV Preps
TypeCollection....cTNT.iCre cTnT tdTomato 9 Pu 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson 196410 AAV-GfaABC1D-Cre... -
Trimmer Lab NeuroMab Collection
TypeCollection...Laforin Human Mouse IgG2a 114536 Anti-GFAP R416WT [N206B/9R] GFAP R416WT Human Mouse IgG2a 114538 Anti-...] Frataxin Human Mouse IgG2a 177512 Anti-GFAP [N206A/8R] GFAP Human Mouse IgG2a 177513 Anti-LRP4 (extracellular...-2b] RGS14 Rat Mouse IgG2b 199410 Anti-GFAP [N206A/8R-2b] GFAP Human Mouse IgG2b 199412 Anti-Cav1.2 Ca2...Neurexin-1-Beta Human Mouse IgG1 206703 Anti-GFAP [N206A/8R-1] GFAP Human Mouse IgG1 206705 Anti-Cav1.2 Ca2.../Rat rat IgG2a 225421 GFAP (Homo sapiens) recombinant monoclonal antibody. GFAP Human Chimera: Mouse/Rat...Neurexin-1-Beta Human Mouse 199426 GFAP scFv [N206A/8] N206A/8 scFv GFAP Human Mouse 199428 MAP3K12 scFv ... -
Caltech Systemic Capsids
TypeCollection...Cre-EGFP expression Cre Wilson 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP Cre-expression Cre Wilson 107738 pAAV-hSyn-Cre-P2A-dTomato... -
Validated gRNA Sequences
TypeCollection...TGGTCCGTCTAGAAACTCGGTAC 64159 activate S. pyogenes 25619936 Sato gfap D. rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes... -
Penn Vector Core Partnership with Addgene
TypeCollection...Douglas Kim AV-1-PV2914 98930-AAV1 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV3080...Douglas Kim AV-5-PV2914 98930-AAV5 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-5-PV3107...Douglas Kim AV-9-PV2914 98930-AAV9 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-9-PV3081... Philip Haydon AV-5-PV2407 105549-AAV5 pAAV.GFAP.eGFP.WPRE.hGH Control James M. Wilson AV-5-PV3106 44332...James M. Wilson AV-5-PV2408 105550-AAV5 pAAV.GFAP.Cre.WPRE.hGH Cre Recombinase James M. Wilson AV-6-PV1090...