Skip to main content
Addgene

We narrowed to 42 results for: POR C

Showing: 1 - 20 of 42 results
  1. Worm Expression Resources

    Type
    Collection
    ... below lists plasmids that contain a worm ( C. elegans, C. briggsae , etc.) gene or sequence: ID Plasmid...Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Cloning-free CRISPR for C. elegans , which uses...to generate transgenic nematodes, including C. elegans and C. briggsae. Other related miniMos plasmids ...General Tools Fire Lab C. elegans Vector Kit - Andrew Fire Lab. A set of vectors for C. elegans research, ...distributes stocks of C. elegans. Silencing Genomes - Cold Spring Harbor's guide to RNAi in C. elegans WormAtlas...microscopy experiments. The C. elegans genome is well studied and hundreds of reporters have been developed and...Hubbard Lab. Plasmids for the temporal and spatial control of gene expression in C. elegans by combining expression...
  2. Immunology Research Plasmids and Resources

    Type
    Collection
    ...CCL1 chemokine (C-C motif) ligand 1 I-309, P500, SCYA1, SISe, TCA3 CCL11 chemokine (C-C motif) ligand 11...chemokine (C-C motif) ligand 13 CKb10, MCP-4, MGC17134, NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif...chemokine (C-C motif) ligand 19 CKb11, ELC, MGC34433, MIP-3b, MIP3B, SCYA19 CCL2 chemokine (C-C motif) ligand...chemokine (C-C motif) ligand 20 CKb4, LARC, MIP-3a, MIP3A, SCYA20, ST38 CCL21 chemokine (C-C motif) ligand...CCL24 chemokine (C-C motif) ligand 24 Ckb-6, MPIF-2, MPIF2, SCYA24 CCL25 chemokine (C-C motif) ligand 25...chemokine (C-C motif) ligand 26 IMAC, MGC126714, MIP-4a, MIP-4alpha, SCYA26, TSC-1 CCL27 chemokine (C-C motif...CCL28 chemokine (C-C motif) ligand 28 CCK1, MEC, MGC71902, SCYA28 CCL3 chemokine (C-C motif) ligand 3 ...
  3. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...: 95 °C for 15 min, 35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10...following parameters: 37 °C for 30 min; 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. Dilute oligos...parameters: Cycles 1-20 (37 °C for 5 min, 20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling ...Incubate at 30 - 37 °C for 24 - 72 hr. 30 °C may enhance genome editing efficiency, but 37 °C is acceptable....cells to incubate at 37 °C for 3 - 7 days and allow the clones to incubate at 37 °C for 7 - 14 days. Vary...thermocycler and run the following program: 65 °C for 6 min, 98 °C for 2 min to extract gDNA. Measure the DNA...clones. Run sample in thermocycler: 65 °C for 6 min and 98 °C for 2 min to extract gDNA. Screen each clone...
  4. CRISPR Guide

    Type
    Collection
    .... A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C., Stan, T., Tysinger, E...Dalvai, M., Loehr, J., Jacquet, K., Huard, C. C., Roques, C., Herst, P., Côté, J., & Doyon, Y. (2015)....Heussler, G. E., Hearne, C. C., Qu, J., Inclan, Y. F., Hawkins, J. S., Lu, C. H. S., Silvis, M. R., Harden...this strategy yields C to A base edits, whereas in mammalian cells, it produces C to G edits. Adenine ... Cas3 must be paired with the Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex...and Cas12a (also known as Cpf1) Cascade C RISPR- as sociated c omplex for a ntiviral de fense; a complex..., S., Bietz, A., Waldhauer, M. C., Börner, K., Fakhiri, J., Schmelas, C., Dietz, L., Grimm, D., Correia...
  5. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... Backbones Flag Epitope tag c-Flag pcDNA3 or FLAG-HA-pcDNA3.1 - C-terminal Flag or N-terminal FLAG-HA...pNIC-CTHF - C-terminal TEV-His6-Flag for bacterial expression pFA6a vectors - PCR-based C-terminal...Epitope tag pcDNA3.1-HA or c-Flag pcDNA3 - Mammalian expression vector with N- or C-terminal HA tag pInducer20...trp mTagBFP2-pBAD - Protein expression vector with C-terminal mTagBFP2 tag pNIC-GST-TEV-GG - Cloning of...Gileadi lab Worm unc-54, variety of worm gene promoters C. elegans vector kit - Collection of...of plasmids from the Fire Lab L4440 - RNAi in C. elegans Also see our Worm Plasmids and...purification. Just remember to remove the stop codon for C-terminal tags and omit the start codon for N-terminal...
  6. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early...-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc ...pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling...pCMV-mGold-Tubulin-C-18 Microtubules alpha-tubulin mGold Francois St-Pierre 158009 pCMV-mGold-Actin-C-18 Actin ... ABCb10 GFP Orian Shirihai 158003 pCMV-mGold-CAF1-C-10 Nucleus CAF-1 mGold Francois St-Pierre 27705 CAV1...Chromatin HP1 gamma GFP Tom Misteli 55068 mCherry-LaminA-C-18 Nuclear Envelope LaminA1 mCherry* Michael Davidson...cycle) Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell cycle) Cep170 EGFP...
  7. Plasmids for Stem Cell Research

    Type
    Collection
    ... state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency...Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids A drug-...for the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells Produced ...lentiviral vector for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming... Lentivirus Human Expression of human Klf4, Oct4, c-Myc, and Sox2 as VP-16 transcriptional activating ...polycistronic expression of human Oct4, Klf4, Sox2, c-Myc and hairpin RNA p53 for single plasmid reprogramming...retroviral expression of human Sox2, Oct3/4, Klf4, and c-Myc from four separate plasmids Induction of pluripotent...
  8. Deisseroth INTRSECT Collection

    Type
    Collection
    ...window) Poulin JF, Caronia G, Hofer C, Cui Q, Helm B, Ramakrishnan C, Chan CS, Dombeck DA, Deisseroth K...Navarro M, Burnham N, Cristiano C, Dorrier CE, Tipton GJ, Ramakrishnan C, Kozicz T, Deisseroth K, Thiele...Markovic M, Wolff SB, Ramakrishnan C, Fenno L, Deisseroth K, Herry C, Arber S, Lüthi A. 2016. Midbrain ...been expanded to incorporate VCre in order to enable three-feature cell targeting. C) Example of viral...processing, producing a functional molecular tool (C,F). Implementation The following resources may be ...Vcre No References Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu ...Grosenick L, Zalocusky KA, Bernstein H, Swanson H, Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, Deisseroth...
  9. Validated gRNA Sequences

    Type
    Collection
    ...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...
  10. TALEN Plasmids and Kits

    Type
    Collection
    ...containing unique shorter N- and C-terminal domains (N153AA, C47AA). The reporter vector pGL4-SSA can be used...GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation at rates much higher...pCS2 expression vector resulting in shorter N- and C-terminal tal protein segments (136AA and 63AA, respectfully...promoter. Truncations were introduced to the N- and C-terminus of the pTAL3 TALEN backbone, which were initially...wild-type TAL amino acids after the repeat domain, and C-terminal SV40 NLS and HA tags. Plasmid 47389 also ... of the minimal activation domain of VP16) at the C terminus. 47389 pcDNA3.1-GoldenGate-VP64 Golden Gate...expression, and encode one of three 0.5 TALE repeats (C, T, and G) and the full length human LSD1 at the carboxy-terminus...
  11. CRISPR Plasmids - Tagging

    Type
    Collection
    ... N- or C-terminal tagging in Drosophila cells. N terminal tagging in Drosophila cells 3.2 MB C terminal...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...lab deposited a plasmid which introduces an N- or C- terminal affinity tag (3xFLAG-2xSTREP) on endogenous...CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous proteins. The PITCh system ...CRISPR targeting vectors to insert genetic tags in the C. elegans genome. The SapTrap reaction produces a single...genome modification. This system can be used to create C- and N-terminal epitope tags. The plasmids in the ...terminal tagging in Drosophila cells 3.3 MB Seydoux C. elegans Tagging System Geraldine Seydoux's lab has developed...
  12. CRISPR Plasmids - CRISPR Transposases (CAST)

    Type
    Collection
    ...enzymes that form a complex called Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense), and four...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...applications where orientation of the insert is important. However, type I-F CASTs favor insertion in the...
  13. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...Ter Haar, C. M., Rogulina, S., Amrofell, M. B., Isaacs, F. J., Rinehart, J., & Jewett, M. C. (2015). Robust...the N-terminal portion of split mCherry, while a phosphobinding domain is fused to the C-terminal mCherry...Link opens in a new window) Barber, K. W., Miller, C. J., Jun, J. W., Lou, H. J., Turk, B. E., & Rinehart..., T., Guo, L., Osborne, E. M., Benner, J., Noren, C. J., Rinehart, J., & Söll, D. (2011). Expanding the... has developed several tools useful for the incorporation of phosphoserine into your gene of interest.... where it recognizes the UAG amber codon and incorporates phosphoserine into the growing polypeptide chain...University changed the way researchers can explore important questions surrounding serine phosphorylation by...
  14. Rett Syndrome

    Type
    Collection
    ...window) C-terminal Anti-MECP2 (M6818) mouse antibody from Sigma (Link opens in a new window) C-terminal...localization signal (not essential for localization) the C - t erminal D omain (CTD) The most common missense... than mutations further downstream in the NID and C-terminus. A large number of mutations are known to...26944080 (Link opens in a new window) Alysson Muotri c.806delG 806delG G269Afs*20 M Fibroblasts & iPSC Unpublished... cluster in the MBD and NID demonstrating the importance of binding to methylated DNA and the recruitment...syndrome at the molecular level. They are also an important tool for developing therapeutic strategies to ...MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell line (Link opens in a new window) PMID: 35148843...
  15. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...LRRK2 C-His LRRK2 His polH Parkinson's Michael J Fox Foundation MJFF 40376 pBACgus/LRRK2 1867-2141 C-His...2161 C-His LRRK2 His polH Parkinson's Michael J Fox Foundation MJFF 40378 pBACgus/LRRK2 1867-2176 C-His...2161 C-His_T2031E LRRK2 His polH Parkinson's Michael J Fox Foundation MJFF 40381 pBACgus/LRRK2 C-His_G2019S...2161 C-His_G2019S LRRK2 His polH Parkinson's Michael J Fox Foundation MJFF 40383 pBACgus/LRRK2 C-His_C2024S...mCherry-MAPTau-C-10 MAPT mCherry CMV Parkinson's, FTD Michael Davidson 55311 mTagBFP2-MAPTau-C-10 MAPT mTagBFP2... mKO2-MAPTau-C-10 MAPT mKO2 CMV Parkinson's, FTD Michael Davidson 58112 tdTomato-MAPTau-C-10 MAPT tdTomato... CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's Mark Cookson 13315 pcDNA-DEST53...
  16. TALEN Guide

    Type
    Collection
    ...Center (www.taleffectors.com) . Whether you work in a C. elegans lab and have been struggling to mutate a ..., Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic...using engineered TALENs. Sander JD, Cade L, Khayter C, Reyon D, Peterson RT, Joung JK, Yeh JR. Nat Biotechnol...every 35bp. Researchers are still determining the importance of context for each TAL effector within an array...plasmid toolbox. Addgene has rapidly become an important resource for this new technology, and we hope ...
  17. Viral Production

    Type
    Collection
    ...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ...Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by Addgene or ...expression and/or function. These data are sometimes reported or posted on the material page for the corresponding...recipient's initial thaw will be accounted for in our reported titers. Lentiviral vectors are titered using a...This DNA is then used as a template to amplify a portion of the intended lentiviral insert. During this ...
  18. Luciferase Plasmid Collection

    Type
    Collection
    ...Multi-luciferase reporter vector including five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...Alberto Macho 174051 pGWB-cLUC Firefly Creation of C-terminal Fifrefly luciferase fragment for split-luciferase...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Luminopsins : Luciferase-opsin... 64034 pGL4Luc-RLuc Firefly, Renilla Dual reporter reporter vector allowing the study of biscistronic ...for gene expression assays and bioluminescent reporters. Plasmid...Collection Empty Backbones Expression Constructs Reporter Constructs Other Highlights You may also like....
  19. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...3rd 4 78,637 Broad GPP Humagne Set C and Humagne Set D 172650 (Set C) 172651 (Set D) Knockout Human Doench...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pneumoniae M. tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus...collection differ based on some important criteria, and it is important to know which library best...mind: CRISPR screening experiments require electroporation to amplify the pooled library and the use of...best suits your particular experiment. Some important variables include: Type of genetic modification - ...Human Bonifacino 3rd 6-25 11,108 Borodina Yeast Transporter Libraries 153101-153106 Knockout Yeast Borodina...
  20. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein DR274 42250 C. elegans BsaI none S. pyogenes...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pyogenes Zhang PX854 62886 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang pGuide 64711 Mammalian ...pyogenes Zhang PX852 62884 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang PX855 62887 Mammalian BbsI...pyogenes Zhang PX856 62888 Mammalian BbsI yes, activate, C-terminal S. pyogenes Zhang pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B...Bullock and Port pCFD2-dU6:2gRNA 49409 Fly BbsI none S. pyogenes Virmilion Bullock and Port pDCC6 59985...Drosophila BbsI none S. pyogenes Virmilion Bullock and Port pAc-sgRNA-Cas9 49330 Drosophila BspQI yes, cut S...
Showing: 1 - 20 of 42 results