We narrowed to 7 results for: Tef;
-
TypeCollection... Hanna TEF S. cerevisiae TTGATATTTAAGTTAATAAA 62320 scaffold S. pyogenes 25533786 Qi & Lim TEF1 S. cerevisiae...
-
Cre-lox system
TypeCollection...60930 pPL5071_TEF1*-Cre_URA3 Cre expressed at low levels mutant TEF2 Yeast Piper 60931 pPL5608_TEF1*-Cre_TRP1... mutant TEF1 Yeast Piper 60932 pPL5606_TEF1*-Cre_ADE2 Cre expressed at low levels mutant TEF1 Yeast Piper...Piper 60933 pPL5628_TEF1*-Cre_MET15 Cre expressed at low levels mutant TEF3 Yeast Piper 61391 pCS2-Cre.zf1... -
Botman-Teusink Yeast FP Collection
TypeCollection...p415 plasmid (Loqué et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km ...Km plasmid (Vickers et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid... -
NETRF
TypeCollection...academic researchers around the world. The NETRF is grateful for the generous support of philanthropic individuals... -
AAVED
TypeCollection...Contact us at [email protected] Sponsor We are grateful to The Kavli Foundation for supporting this meeting... -
TALEN Plasmids and Kits
TypeCollection...galactose-inducible expression. pTAL6-BB contains the TEF1 promoter, giving constitutive expression of TALORs... -
Neurodegeneration Plasmid Collection
TypeCollection...-12 splicing minigene MAPT CMV Parkinson's, FTD Stefan Stamm 121992 pHBS941 TDP43 RRM-GFP VLIMFYW-S TARDBP...