We narrowed to 5 results for: dcas9 dnmt3a
-
TypeCollection...researchers have fused catalytically dead Cas9 (dCas9) to epigenetic modifiers. Common modifiers include...TET1 — activation through cytosine demethylation DNMT3A — repression through cytosine methylation MQ1 —...
-
CRISPR Plasmids - Mammalian Expression
TypeCollection...PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional repressor peptide...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors... CRISPR Blog Posts Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein becomes a ...Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator peptide can...specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your... separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene... separate gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...separate accessory pack is available for dCas9 and FokI-dCas9. Yamamoto Multiplex CRISPR/Cas9-based genome...vector Mammalian Lentiviral expression of Cas9, dCas9, or dCas9-VP64 along with 1-4 sgRNAs expressed from independent...Mammalian S. pyogenes Neo, mCherry Postovit pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes, methylation...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...Mammalian U6 yes, nick S. pyogenes Conklin pXFokI-dCas9 60901 Mammalian U6 yes, FokI S. pyogenes Conklin...Mammalian U6 none S. aureus Joung pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro 71236 Mammalian/Lentiviral hU6 yes... -
CRISPR Guide
TypeCollection...achieved by using orthogonal dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent...human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly to a single...imaging of proteins in living cells (Figure 9B) dCas9-VPR — dCas9 fused to several different activation domains...Jonathan Weissman labs , is an all-in-one dCas9 fusion with KRAB, DNMT3A, and DNMT3L. CRISPRoff maintains gene...utilizes biotin tagging of dCas9 by fusing a biotin acceptor site to dCas9 and co-expressing BirA biotin... defense CRISPRa CRISPR Activation; using a dCas9 or dCas9-activator with a gRNA to increase transcription...target gene CRISPRi CRISPR Interference; using a dCas9 or dCas9-repressor with a gRNA to repress/decrease transcription... -
Validated gRNA Sequences
TypeCollection...Sabatini DNMT3A H. sapiens GAGATGATCGCCCCTTCTTC 41822 cut S. pyogenes 23287722 Church DNMT3A H. sapiens...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...