We narrowed to 4 results for: lox-stop-lox
-
TypeCollection...Expression: Placing a stop codon with loxP sites on either side (often called a “lox-stop-lox” or “LSL” cassette...Lentiviral Jacks 11584 Lox-Stop-Lox TOPO Cre activates gene of interest by removing Stop sequences; Puro selection... gene expression to physiological levels. In lox-STOP-lox shRNA constructs, Cre expression promotes shRNA...Cre-lox Plasmids Addgene's Blog: Cre-lox Addgene's Blog: FLEx Vectors Cre-containing Plasmids loxP Constructs...pENTR-Cre Cre with stop codon Entry vector Ko 139546 pENTR-CreStopDeleted Cre without stop codon Entry vector... Plasmid Collections Cre-lox Plasmids Cre-lox Plasmids Additional...out Addgene’s Plasmids 101: Cre-lox blog post. Based on these Cre-lox recombination principles, scientists...
-
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Expression Vectors page Cre-lox Site-specific recombination See our dedicated Cre-lox Plasmids page pBF3060 ...protein purification. Just remember to remove the stop codon for C-terminal tags and omit the start codon...including plasmids for constitutive, conditional (Cre-lox), or inducible (Tet) expression miRNA and 3' UTR ... -
Validated gRNA Sequences
TypeCollection...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S... -
Genetic Code Expansion
TypeCollection...challenging. In E.coli , the rarest codon is the amber stop codon (UAG) and thus this codon is often used. The...Mut1-RS tyrosyl-tRNA synthetase M. jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram...Mut2-RS tyrosyl-tRNA synthetase M. jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram...