We narrowed to 5 results for: lox-stop-lox
-
TypeCollection...Gene Expression: A stop codon flanked with loxP sites (often called a "lox-STOP-lox" or "LSL" cassette... gene expression to physiological levels. In lox-STOP-lox shRNA constructs, Cre expression promotes shRNA...Cre, the stop codon is excised, and gene expression proceeds. Gene Knockout: Placing the loxP sites on...shRNA Expression: Cre-lox can be used to turn shRNA constructs on or off. In floxed-shRNA constructs, Cre...Learn about Cre-Lox and other site-specific recombinase systems, how to use them to modify the genome... Plasmid Collections Recombinases Cre-Lox and Other Site-Specific Recombinases Cre Plasmids...Read on to learn about the different ways that Cre-lox and other site-specific recombinases can be used ...
-
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Expression Vectors page Cre-lox Site-specific recombination See our dedicated Cre-lox Plasmids page pBF3060 ...protein purification. Just remember to remove the stop codon for C-terminal tags and omit the start codon...including plasmids for constitutive, conditional (Cre-lox), or inducible (Tet) expression miRNA and 3' UTR ... -
Validated gRNA Sequences
TypeCollection...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S... -
Bacterial Expression Systems
TypeCollection...CRISPR Plasmids and Resources page. Check our Cre-Lox Plasmids Collection for a selection of plasmids containing...Mycobacterium sp. Ashwani Kumar 134405 pBbAW4k-loxP-TT-loxP-mRFP1 Cre recombinase activity Fluorescence ...benzoate (cumate) Methylobacterium extorquens Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline...Anhydrotetracycline (aTc) Methylobacterium extorquens Christopher Marx 122635 pPEPZ-Plac Plac Lactose/IPTG Streptococcus...PcpcG2 Green Light (532 nm) Escherichia coli Christopher Voigt 164226 pSCrhaB2plus PrhaBAD Rhamnose Burkholderia...Fluorescence (GFP:mRFP1 ratio) Escherichia coli Christopher Voigt 65008 pCRISPReporter-mCherry Promoter activity... -
Genetic Code Expansion
TypeCollection...challenging. In E.coli , the rarest codon is the amber stop codon (UAG) and thus this codon is often used. The...Mut1-RS tyrosyl-tRNA synthetase M. jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram...Mut2-RS tyrosyl-tRNA synthetase M. jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram...