Skip to main content
Addgene
Showing: 1 - 3 of 3 results

  1. Cre-lox system

    Type
    Collection
    ...Expression: Placing a stop codon with loxP sites on either side (often called a “lox-stop-lox” or “LSL” cassette...Lentiviral Jacks 11584 Lox-Stop-Lox TOPO Cre activates gene of interest by removing Stop sequences; Puro selection... gene expression to physiological levels. In lox-STOP-lox shRNA constructs, Cre expression promotes shRNA...Cre-lox Plasmids Addgene's Blog: Cre-lox Addgene's Blog: FLEx Vectors Cre-containing Plasmids loxP Constructs...pENTR-Cre Cre with stop codon Entry vector Ko 139546 pENTR-CreStopDeleted Cre without stop codon Entry vector... Plasmid Collections Cre-lox Plasmids Cre-lox Plasmids Additional...Mammalian Green 8406 p252 pPr-CREM/CMV-STOP-luc CREM and CMV-STOP-luc cassette probasin Mammalian Green...

  2. Validated gRNA Sequences

    Type
    Collection
    ...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S...

  3. Genetic Code Expansion

    Type
    Collection
    ...challenging. In E.coli , the rarest codon is the amber stop codon (UAG) and thus this codon is often used. The...Mut1-RS tyrosyl-tRNA synthetase M. jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram...Mut2-RS tyrosyl-tRNA synthetase M. jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram...
Showing: 1 - 3 of 3 results