...of Cre, the stop codon is excised, and gene expression proceeds. One popular lox-stop-lox plasmid is from...termination features with loxP sites on either side (often called a “lox-stop-lox” or “LSL” cassette) upstream...Jack's lab: Lox-Stop-Lox TOPO.  Cre-dependent gene knockout – conversely, putting the loxP sites on either...tissue-specific cell types: Cre-lox recombination. What is Cre-lox? The Cre-lox system is a technology that...translocation event is generated at the loxP sites. How can I use Cre-lox? The Cre/lox system is a well-established...Among these are loxN (GtATACcT), lox2272 (GgATACtT), and lox511 (GtATACAT). These variant lox sites undergo...Cre and loxP, respectively. The FLP-FRT technology can be an effective alternative to Cre-lox, and has...

...have two pairs of lox sites which are part of a dual lox system called FLEX or DIO. Lox sites are recognized...transfer plasmid, but are often seen in them.  Lox sites Lox sites, in combination with the Cre recombinase...with AAV before, but you aren’t going to let that stop you. Where do you start? Turns out like all good...spatially and temporally control transgene expression. Lox sites are directional 34 bp sequences that can flank...first flips the sequence between the first pair of lox sites, and then excise the sequence between the second...transgene. By restricting the availability of Cre, lox sites lets researchers control the spatial and temporal...activation of a transgene. Figure 2: FLEX Cre-Lox system.  WPRE The Woodchuck Hepatitis Virus (WHP...

...continued utility of Cre-lox. Check out our previous blog post, Plasmids 101: Cre-lox, if you need a quick...quick primer on how Cre-lox recombination works. Advances in Cre-lox recombination have included inducible... translation-blocking STOP cassette immediately following the promoter. The STOP cassette includes a mutant...manipulation systems remain valuable to biology. Cre-lox recombination, discovered in the 1980s, is one of...expression, especially in in vivo models, and new Cre-lox based technologies are still being developed today...tamoxifen-responsive CreERT, the coupling of Cre-lox with FLP-FRT recombination to generate additional...Cellular Biology, harnessed these attributes of Cre-lox to create the Brainbow mouse neural labeling system...

...recombinase, which induces recombination at LoxP sites. Placing a lox-STOP-lox cassette upstream of a gene of interest...T-DDOGs can be used in combination with green-red Cre-lox systems. T-DDOGs can also be designed with other ...Cre is absent. When Cre is present, it removes the STOP cassette, activating gene expression. Although Cre...121. PubMed PMID: 22157958. Addgene Resources Cre-lox Resource Guide Fluorescent Protein Resource Guide... cre-lox...

...of a stop cassette upstream of the target gene in the targeting vector. The stop cassette is floxed, so...deletes the stop cassette, which permits expression of the target gene. In addition, Cre-lox systems can...Cre-lox Read our genome engineering blog posts Resources on Addgene.org Find more about Cre-lox Read..., conditional knockout/knockin mice, use the Cre-lox recombination system to express the transgene in ...recombination of DNA sequences located between two loxP sites. The loxP sites are present at both ends of a gene... vector, creating the floxed gene segment. Crossing of mice containing a floxed gene to a Cre-expressing...recombination. To generate a conditional knockout mouse, loxP sites are inserted directly into the genome to flank...

...Expression: Placing a stop codon with loxP sites on either side (often called a “lox-stop-lox” or “LSL” cassette...Lentiviral Jacks 11584 Lox-Stop-Lox TOPO Cre activates gene of interest by removing Stop sequences; Puro selection... gene expression to physiological levels. In lox-STOP-lox shRNA constructs, Cre expression promotes shRNA...Cre-lox Plasmids Addgene's Blog: Cre-lox Addgene's Blog: FLEx Vectors Cre-containing Plasmids loxP Constructs...pENTR-Cre Cre with stop codon Entry vector Ko 139546 pENTR-CreStopDeleted Cre without stop codon Entry vector... Plasmid Collections Cre-lox Plasmids Cre-lox Plasmids Additional...Mammalian Green 8406 p252 pPr-CREM/CMV-STOP-luc CREM and CMV-STOP-luc cassette probasin Mammalian Green...

...recombinase-dependent vector designs used a lox-STOP-lox (LSL) or frt-STOP-frt (FSF) sequence prior to an ATG ...unused (loxp) sites will be flanked by two lox sites now in the same orientation. Next, the loxp site is... to the system it binds one pair of lox sites, let's say the loxp pair, and flips the transgene into the...Cre-recombinase binds to either pair of lox sites, let's say the lox2272, that are in the opposite orientation...Recombinase-dependent vectors utilize pairs of specific sequences, lox (recognized by Cre) or frt (recognized by Flp), to... hypothesis, they randomly scrambled one pair of lox sites and either used the same sequence to flank ... in one loxp site and one lox2272 site on either end of the transgene. Since loxp and lox2272 can not ...

...Cre-lox recombination is an incredibly useful molecular biology tool, but like any biological system,...bisporus.) Reporter constructs equivalent to site-STOP-site-myrRFP, with “site” representing the specific...resulted in complete or near-complete excision of the stop sequence. In contrast, Dre recombinase, the close...  cre-lox...Cre may induce recombination at pseudo- or cryptic loxP sites (estimated to occur at a frequency of 1.2 ... systems, Cre itself, without the presence of a floxed construct, may produce a phenotype. This problem...458-65. doi:10.1007/s004270100167. PubMed. Cryptic loxP sites in mammalian genomes: genome-wide distribution...

... Cre-Lox mouse models in which the endogenous MECP2 gene was disrupted and silenced by a Lox-Stop cassette...Syndrome. Restoring the MECP2 gene by excision of the Stop cassette using tamoxifen-inducible Cre not only ...

...start of the day and throughout daytime. They mostly stop emerging at night. An incubator with a light cycle...genetic crosses. More importantly, this knowledge will stop you from embarking on a fruitless journey of trying...Specific Recombination in Drosophila Learn about Cre-Lox Resources on Addgene.org Find Drosophila Plamids...

...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S...

...orange) (Livet et al., 2007). Brainbow uses a Cre/lox system to label neurons. Genes encoding the fluorescent...express the same XFP transgene in an adult fly. As a stop cassette is located directly upstream of the fluorescent...Brainbow 2.1 construct in the Rosa26 locus, under a loxP “roadblock” so that XFP are only expressed following...

...s a guide that directs cleavage right before the stop codon!  Figure 3: How to design a C-terminal...guide would be selected, since it cleaves at the stop codon TAG. Design your repair template with ...allele The design for a floxed conditional allele requires you to target 2 loxP sites to intronic regions...original design for creating a conditional allele, or floxed mouse, from Yang et al. requires two gRNAs targeting... and two repair templates in order to insert two loxP sites. Since two double-strand breaks are made, ...variety of other undesired outcomes, including one loxP site insertion and one NHEJ-repaired indel, often... - 0.8 kb apart. In the example below, we’ll add loxP sites for conditional deletion of exon 6 of Syt1...

... are provided in both open (no stop codon) and closed (including a stop codon) formats. The collection...Lab used this backbone to target a CAG-driven loxP-stop-loxP cassette into the Rosa26 locus, allowing for...Commonly used sequences, including fluorescent tags, a floxed Cbr-unc-119 selectable marker, and “connectors”...

...disease has now become much like the 1980s song “Don’t Stop Believin’”; whenever you hear it (whether at a scientific...these needs is the lentiviral-based expression of floxed dCas9 so that it may later be excised by Cre recombinase...

...resistance gene (missing the first two codons). Two stop codons are inserted between the truncated gene and...ligated into the MCS/SacI site in pUCXKT, removing the stop codons during backbone digestion and providing the...bound to the mRNA since they are tethered AFTER the stop codon. Thus a non-translated mRNA will appear yellow...variety of bio-orthogonal UAAs via a re-assigned stop codon (TAG). This polyspecificity enables the site-specific...terminators and various pieces for inducible expression, loxP sites, H2B, P2A or PEST2D sequences. Several pre-constructed...

...challenging. In E.coli , the rarest codon is the amber stop codon (UAG) and thus this codon is often used. The...Mut1-RS tyrosyl-tRNA synthetase M. jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram...Mut2-RS tyrosyl-tRNA synthetase M. jannaschii 4-propargyloxy-l-phenylalanine (pPR) Bacterial TAG Miriam Amiram...

...We now offer AAV9 for 2 more constructs from Christopher Harvey’s lab. These plasmids localize opsins ...pAAV-mDlx-NLS-mRuby2 112677 AAV1, AAV2 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP ... mCherry 112677 AAV2 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP 50457 AAV2 pAAV-hSyn-DIO-EGFP ...

...GABAergic interneurons. pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5 and 112677-AAVrg): The...recently packaged a soma-targeted opsin from Christopher Harvey’s lab. According to their publication ...)-mCherry (26976-AAV5) pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5) Calcium Sensors pGP-AAV-syn-jGCaMP7b-WPRE...