We narrowed to 10 results for: luciferase reporter
-
TypeCollection...CMV Dual secreted luciferase reporter (EF1α-Gaussia luciferase, CMV-Cypridina luciferase). Feng Zhang Return... of luciferase found in Addgene's collection include: Firefly luciferase (Fluc) Renilla luciferase (Rluc...respectively), Cypridina luciferase , and Luciola luciferase . Each type of luciferase has advantages and disadvantages...Multiple Multiple Multi-luciferase reporter vector including five transcriptional reporters for NF-kb, TGF-b,...collection of luciferase plasmids for gene expression assays and bioluminescent reporters. Plasmid...Collections Luciferase Plasmids Luciferase Plasmid Collection Empty Backbones Expression Constructs Reporter...Fluorescent Proteins Blog: Luciferase 101 Blog: Technologies Enabled by NanoLuc® Luciferase Blog: Luminescent ...
-
Promega Plasmid Collection
TypeCollection...HiBiT, and more. Luciferase Reporters Luciferase (Link opens in a new window) reporter assays use light...Find luciferase reporter vectors for sensitive gene expression analysis and fusion vectors containing...experimental workflows. The collection contains luciferase reporter vectors for sensitive gene expression analysis...search by response element, reporter, protein, or tag, such as "NFAT", "luciferase", "Ras", "NanoLuc", "HaloTag...NanoLuc luciferase-fusion protein expressed in cells. Additional Resources Browse Addgene's Luciferase Plasmid...Addgene Find additional information about luciferase reporter assays (Link opens in a new window) from ... 19.1 kDa and exceptionally bright and stable luciferase that enables highly sensitive detection at endogenous... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection... Lentiviral reporter vector expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing...expressing firefly luciferase and ZsGreen. NL4-3 mCherry Luciferase - Lentiviral dual reporter vector expressing...EGFP. Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly luciferase with neomycin...Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that can be used for...expressing firefly luciferase. pHAGE-CMV-Luc2-IRES-ZsGreen-W - Lentiviral dual reporter vector expressing...expressing mCherry and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro - Lentiviral... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...TALEN array for genomic engineering Luciferase Reporter See our Luciferase collection of plasmid backbones... to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ... genes can be inserted into this firefly luciferase reporter to test for their effects on protein production...expression (Gateway) pYIC - Bicistronic fluorescent reporter gene with cap-dependent 3Myc-EYFP-HA-His6 and ...for viral vector delivery, genome modification, reporter assays, shRNA expression, transgenics, and more...page for more information Genome Modifications, Reporter Assays, mRNA Regulation, and More Find empty backbones...backbones for other uses such as genome modification, reporter assays, shRNA expression, transgenics, and more... -
Bacterial Expression Systems
TypeCollection...Optogenetics for E. coli Return to top Reporter Plasmids Reporter plasmids can be used to detect events...Plasmids containing easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under...proteins and specific DNA sequences. ID Plasmid Reports Reporter Mechanism Expression Species PI 14474 pRU1161...transcription factors. Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors ...protein interactions, controlled gene expression, reporter plasmids and genome engineering of bacteria. Plasmid...Visualization Protein Interactions Controlled Expression Reporter Plasmids Genome Engineering You may also like…...transcription factor to bind to a small molecule, the reporter plasmid can be used to detect the presence of ... -
COVID-19 Resources
TypeCollection...pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been used for ...activity reporter of SARS-CoV-2 main protease Mpro. (Unpublished) A FlipGFP-based activity reporter of SARS-CoV...method termed Specific High Sensitivity Enzymatic Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). The Broad... termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has published information...(Link opens in a new window) CRISPR tools and reporters now available from Stanley Qi's lab. COVID-19 ... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...Plasmids Recombinase-Dependent Empty Backbones Reporter Plasmids Pooled Libraries/Kits You may also like...recombinases , as well as useful empty backbones or reporters . Experimental Considerations Recombinase Recognition... plasmids. Return to top Recombinase-Dependent Reporter Plasmids Incorporating a fluorescent protein into...visualize which cells have undergone recombination. Reporter plasmids can also be useful for lineage tracing...Use this AAV CRISPR knockout library expressing luciferase and Cre to interrogate tumorigenesis in vivo ... -
Fluorescent Protein Guide: Biosensors
TypeCollection...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing...maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation process by a novel reporter protein... DsRed1-E5 as a reporter for mitochondrial oxidative stress A novel MitoTimer reporter gene for mitochondrial...Multicoloured voltage reporters (QuasAr2) Bright and fast multicoloured voltage reporters via electrochromic...You may also like... Addgene Blog: Biosensors Luciferase Plasmids Subcellular Localization Optogenetics...genetically encoded calcium sensor (GECI) that reports with lifetime and intensity changes A turquoise...Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins Ratiometric... -
Tetracycline Inducible Expression
TypeCollection...efficacy by fluorescence, use Plasmid #35626 as a reporter for cDNA target. rtTA3 Ptet, miniCMV Howard Gu...pSBtet-GP Sleeping Beauty transposon system with luciferase in cloning site. See article ( Kowarz et al.,... -
Validated gRNA Sequences
TypeCollection...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...