Skip to main content
Addgene
Showing: 1 - 9 of 9 results
  1. Luciferase Plasmid Collection

    Type
    Collection
    ...types of luciferase found in Addgene’s collection are Firefly luciferase (Fluc), Renilla luciferase (Rluc...Renilla luciferase in plants Diego Orzaez 118069 MLRV Multiple Multiple Multi-luciferase reporter vector...collection of luciferase plasmids for assays of transcriptional regulation and bioluminescent reporters. Plasmid...Plasmid Collections Luciferase Plasmids Luciferase Plasmid Collection You may also like... Fluorescent Proteins...Proteins Blog: Luciferase 101 Blog: Technologies Enabled by NanoLuc® Luciferase Blog: Luminescent Imaging...Empty Backbones Expression Constructs Reporter Constructs Luciferase is the enzyme responsible for the bioluminescence...photobleaching has made luciferase a common choice in assays ranging from use as a reporter gene in vitro and...
  2. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ... Lentiviral reporter vector expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing...expressing firefly luciferase and ZsGreen. NL4-3 mCherry Luciferase - Lentiviral dual reporter vector expressing...EGFP. Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly luciferase with neomycin...Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that can be used for...expressing firefly luciferase. pHAGE-CMV-Luc2-IRES-ZsGreen-W - Lentiviral dual reporter vector expressing...expressing mCherry and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro - Lentiviral...
  3. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...TALEN array for genomic engineering Luciferase Reporter See our Luciferase collection of plasmid backbones... to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ... genes can be inserted into this firefly luciferase reporter to test for their effects on protein production...expression (Gateway) pYIC - Bicistronic fluorescent reporter gene with cap-dependent 3Myc-EYFP-HA-His6 and ...for viral vector delivery, genome modification, reporter assays, shRNA expression, transgenics, and more...page for more information Genome Modifications, Reporter Assays, mRNA Regulation, and More Find empty backbones...backbones for other uses such as genome modification, reporter assays, shRNA expression, transgenics, and more...
  4. Bacterial Expression Systems

    Type
    Collection
    ...Tagging Purification Controlled Expression Reporter Plasmids Reporter Plasmids Tagging and Visualization Purification...expression at a specific level. Return to Top Reporter Plasmids Reporter plasmids can be used to detect events...they activate expression of the reporter gene. Plasmid ID Promoter Reporter PI Purpose pRU Series Various...pTac GFP, Luciferase (LuxCDABE) Attila Karsi Broad host range vectors for expressing luciferase and fluorescent...Purification Controlled Expression Reporter Plasmids You may also like… Plasmids 101 Addgene's Molecular...promoters, their associated transcription factors, and reporter genes. pCS-PesaRlux 47640 PesaR 3OC6HSL (Quorum...Quorum sensing molecule) Cynthia Collins Contains luciferase inducible by the quorum sensing molecule, 3OC6HSL...
  5. Cre-lox system

    Type
    Collection
    ...sites AAV Uchida Cre Reporters and Tools In this subtype of loxP plasmids, reporter genes indicate which...Mammalian Pelczar 62732 Cre Reporter DsRED and EGFP Cre recombinase reporter Lentiviral Geijsen 65726 pLV-CMV-LoxP-DsRed-LoxP-eGFP...cre/loxP reporter Mammalian Hescheler 12463 p231 pCMVe-betaAc-STOP-luc Cre dependent luciferase expression...Vectors Cre-containing Plasmids loxP Constructs Cre Reporters & Tools Additional Resources References Background...Fluorescent Cre: The fusion of Cre to a fluorescent reporter enables visualization of Cre expression. Optimized...backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Cre, luciferase, and sgRNA expression EFS AAV Zhang 60229 AAV...Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer 68448...
  6. COVID-19 Resources

    Type
    Collection
    ...pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been used for ...activity reporter of SARS-CoV-2 main protease Mpro. (Unpublished) A FlipGFP-based activity reporter of SARS-CoV...method termed Specific High Sensitivity Enzymatic Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). The Broad... termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has published information...(Link opens in a new window) CRISPR tools and reporters now available from Stanley Qi's lab. COVID-19 ...
  7. Tetracycline Inducible Expression

    Type
    Collection
    ...single copy in mammalian cells; Expresses firefly luciferase hairpin and GFP under pTREtight promoter None...shRNA efficacy using fluorescence; use with pGFPns-reporter for cDNA target rtTA On Gu 60495 pSBtet-GP Sleeping...Sleeping Beauty transposon system; has luciferase in cloning site; see article for additional selection...
  8. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing...maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation process by a novel reporter protein... DsRed1-E5 as a reporter for mitochondrial oxidative stress A novel MitoTimer reporter gene for mitochondrial...Multicoloured voltage reporters (QuasAr2) Bright and fast multicoloured voltage reporters via electrochromic...You may also like... Addgene Blog: Biosensors Luciferase Plasmids Subcellular Localization Optogenetics...genetically encoded calcium sensor (GECI) that reports with lifetime and intensity changes A turquoise...Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins Ratiometric...
  9. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...
Showing: 1 - 9 of 9 results