Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 1 - 7 of 7 results
  1. Luciferase Plasmids

    Type
    Collection
    ...Taipale 87078 pLenti6.2-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway...Taipale 87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway...Ferrer 87078 pcDNA3.1-ccdB-Nanoluc NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...® Ubc Lentiviral expression of Nanoluc with a N-terminal Myc tag Wanker 113442 pcDNA3.1 NL NanoLuc...NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning Taipale 87074 pLenti6.2-ccdB-Firefly...Fluorescent Proteins Blog: Luciferase 101 Blog: Technologies Enabled by NanoLuc® Luciferase Blog: Luminescent...Expression of adrenoceptor beta 2 fused at C termimus with Natural peptide (NP) of NanoLuc....-3XFLAGExpress 3xFLAG tagged nanoLuciferase (nLuc) from CUG start codonnanoLuciferase...-3XFLAGExpress 3xFLAG tagged nanoLuciferase (nLuc) from AUU start codonnanoLuciferase...
  2. Validated gRNA Sequences

    Type
    Collection
    ...68898 interfere S. pyogenes 26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S....pyogenes 26918244 Lu NanoLuc synthetic TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu...25619936 Sato NANOG H. sapiens TGGTGTCTTCAGGTTCTGTTGCT 64155 activate S. pyogenes 25619936 Sato NanoLuc...synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic GACAGAACGATGCGCTGAAT...
  3. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...Ting pAAV-gLuc sp-NanoLuc-HA-β2AR-NNES-AsLOV2(V416L)gLuc sp-NanoLuc-HA-β2AR-NNES-AsLOV2...-15aa linker-AsLOV2(V416L)HA-β2AR-NNES-NanoLuc-15aa linker-AsLOV2(V416L)Mammalian Expression, AAVpAAVHA...Cre/LoxpOTTC901 - pAAV SYN1 DIO GIRK4-MycHA Richie pAAV-HA-β2AR-NNES-NanoLuc...pAAV-IgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLucIgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLuc...-V5β2AR-NNES-NanoLuc-eLOV-TEVcs-Flag-Gal4-V5 (Synthetic)Mammalian Expression, AAVpAAVFlag, V5...NNES-eLOV-TEVcs-Flag-Gal4-V5 (Synthetic)Mammalian Expression, AAVpAAVFlag, V5 Ting pAAV-NanoLuc...linker-TEVp (Synthetic)Mammalian Expression, AAVpAAV Ting pAAV-β2AR-NNES-NanoLuc-eLOV-TEVcs-Flag-Gal4...-15aa linker-βarrestin2-HA-GS linker-TEVpNanoLuc-15aa linker-βarrestin2-HA-GS linker-TEVp (Synthetic)...sp-HA-CD4-10aa linker-CIBN-NNES-NanoLuc (Synthetic)Mammalian Expression, AAVpAAVHA Ting...-15aa linker-βarrestin2-no HA-GS linker-TEVpNanoLuc-15aa linker-βarrestin2-no HA-GS linker-TEVp (Synthetic...Expression, AAVpAAVHA Ting pAAV-IgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLucIgK...
  4. Brain Initiative Plasmid Collection

    Type
    Collection
    ...-EYFPfusion protein of NanoLuc, Volvox channelrhodopsin-1, and enhanced yellow fluorescent protein for...protein for bioluminescent optogenetics Hochgeschwender 114112pcDNA3.1-CAG-NanoLuc-VChR1...
  5. Synthetic Biology - Browse Plasmids

    Type
    Collection
    ...pMM725IPTG-inducible CRISPRi vector targeting NanoLuc (NL3), constiutive NanoLuc, pNBU2 backbone, AmpRdCas9...pMM731IPTG-inducible CRISPRi vector targeting NanoLuc (NL1), constiutive NanoLuc, pNBU2 backbone, AmpRdCas9...pMM732IPTG-inducible CRISPRi vector targeting NanoLuc (NL2), constiutive NanoLuc, pNBU2 backbone, AmpRdCas9...pMM733IPTG-inducible CRISPRi vector targeting NanoLuc (NL4), constiutive NanoLuc, pNBU2 backbone, AmpRdCas9...pMM659Chondroitin sulfate-inducible NanoLuc expression, pNBU2 backbone, AmpRNanoLucBacterial Expression..., AmpRdCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium...pMM750IPTG-inducible CRISPRi vector targeting PcfiA (PR2), constiutive NanoLuc, pNBU2 backbone, AmpRdCas9...pAT587NanoLuc expressed constiutively from PBT1311 and GH022 RBS, pNBU2 backbone, AmpRNanoLucBacterial...pAT588NanoLuc expressed constiutively from PBT1311 and GH023 RBS, pNBU2 backbone, AmpRNanoLucBacterial...pAT590NanoLuc expressed constiutively from PBT1311 and GH049 RBS, pNBU2 backbone, AmpRNanoLucBacterial...pAT593NanoLuc expressed constiutively from PBT1311 and rpiL* RBS, pNBU2 backbone, AmpRNanoLucBacterial...pAT695NanoLuc expressed constiutively from PBT1311 and RC500 RBS, pNBU2 backbone, AmpRNanoLucBacterial...pMM659Chondroitin sulfate-inducible NanoLuc expression, pNBU2 backbone, AmpRNanoLucBacterial Expression...
  6. Plasmids for Optogenetics Research

    Type
    Collection
    ...pcDNA3.1-CAG-sbGLuc-hGtARC2-EYFP Inhibitory GtARC2 Mammalian EYFP Hochgeschwender 114112 pcDNA3.1-CAG-NanoLuc-VChR1...
  7. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...pMM725dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium...pMM731dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium...pMM732dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium...pMM733dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium...pMM750dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium...pMM763dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium...pMM764dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium...
Showing: 1 - 7 of 7 results