Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 6 results for: nanoluc

Showing: 1 - 6 of 6 results

  1. Luciferase Plasmid Collection

    Type
    Collection
    ...Bryan Welm 87067 pcDNA3.1-ccdB-Nanoluc NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Taipale 87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning... Taipale 87078 pLenti6.2-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Oskar Laur 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Javier Alcudia 113442 pcDNA3.1 NL NanoLuc® CMV Mammalian expression of Nanoluc with a N-terminal Myc tag Erich...Rudolf Jaenisch 113450 pLenti NL NanoLuc® Ubc Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich...the acceptor. LumiFluors: EGFP-NanoLuc ( GpNLuc ) and LSSmOrange-NanoLuc ( OgNLuc ) fusions for BRET-based...

  2. Promega Plasmid Collection

    Type
    Collection
    ...high-throughput screening in drug discovery. NanoLuc Fusions NanoLuc (Link opens in a new window) is a 19.1 ...analysis and fusion vectors containing tags such as NanoLuc, HaloTag, SmBiT, and LgBiT, useful for detecting...detecting and tracking proteins using tags such as NanoLuc, HaloTag, SmBiT, and LgBiT. Ordering & Availability... or tag, such as "NFAT", "luciferase", "Ras", "NanoLuc", "HaloTag", "BiT", or other terms. ID Plasmid ...range of applications. The technology includes NanoLuc, HaloTag, SmBiT, LgBiT, HiBiT, and more. Luciferase...sensitive detection at endogenous expression levels. NanoLuc fusions are useful for both intracellular and extracellular...preserving physiological relevance. NanoBiT Assays NanoLuc Binary Technology (NanoBiT) (Link opens in a new...

  3. Validated gRNA Sequences

    Type
    Collection
    ...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...

  4. Distribution to Industry

    Type
    Collection
    ...Ordering and MTA Information Featured Collections NEW NanoLuc and HaloTag Fusions from Promega COVID-19 SARS-...

  5. Bacterial Expression Systems

    Type
    Collection
    ...Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors Chromoproteins...
Showing: 1 - 6 of 6 results