Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 1 - 11 of 11 results
  1. Technologies Enabled by NanoLuc® Luciferase

    Type
    Blog Post
    Updated
    Nov. 24, 2019, 11:29 p.m.
    ...nanoluc...NanoLuc® Luciferase-based tools are fantastic examples of technologies that can accelerate your research....CalFlux VNT is composed of Venus fluorescent protein, the Troponin C Ca++ binding domain, and NanoLuc® Luciferase....., luc2), and NanoLuc® Luciferase are available from the repository. We encourage people to go to Addgene to get new innovative tools....PubMed PMID: 26006698. 7.Yang, J., et al. (2016) Coupling optogenetic stimulation with NanoLuc-based luminescence (BRET) Ca++ sensing....
  2. Luciferase Plasmids

    Type
    Collection
    ...Lentiviral Gateway-compatible reporter with an N-terminal Nanoluc luciferase Insertion in 3' UTR region Taipale...region Christophe 87789 pPTluc Luciferase reporter for testing enhancer fragments in Drosophila Insertion in 5' UTR region Wijnen 87078 pLenti6.2-Nanoluc-ccdB...
  3. Validated gRNA Sequences

    Type
    Collection
    ...NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes...synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic GACAGAACGATGCGCTGAAT 68898 interfere S. pyogenes 26918244 Lu...TGGGCCTTGGTGAGACTGGTAGA 64154 activate S. pyogenes 25619936 Sato NANOG H. sapiens TGGTGTCTTCAGGTTCTGTTGCT 64155 activate S. pyogenes 25619936 Sato NanoLuc...
  4. Luminescent Imaging with Nano-lanterns

    Type
    Blog Post
    Updated
    Oct. 20, 2019, 12:52 a.m.
    ...These eNL constructs use the brightest characterized luciferase, NanoLuc, and its substrate furimazine....
  5. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...-15aa linker-AsLOV2(V416L)HA-β2AR-NNES-NanoLuc-15aa linker-AsLOV2(V416L)Mammalian Expression, AAVpAAVHA Ting pAAV-gLuc sp-NanoLuc-HA-β2AR-NNES-AsLOV2...hM3D(Gq) (Homo sapiens)Mammalian Expression, AAV, Cre/LoxpOTTC901 - pAAV SYN1 DIO GIRK4-MycHA Richie pAAV-HA-β2AR-NNES-NanoLuc...NNES-eLOV-TEVcs-Flag-Gal4-V5DRD1-NNES-eLOV-TEVcs-Flag-Gal4-V5 (Synthetic)Mammalian Expression, AAVpAAVFlag, V5 Ting pAAV-NanoLuc...Mammalian Expression, AAVpAAVHA Ting pAAV-IgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLucIgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLuc...sp-GS linker-HiBit-Flag-oβ2AR-TS-NNES-eLOV-TEVcs-Flag-Gal4-V5 (Synthetic)Mammalian Expression, AAVpAAVFlag, V5 Ting pAAV-NanoLuc...pAAV-IgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLucIgK sp-HA-CD4-10aa linker-CIBN-NNES-NanoLuc (Synthetic)Mammalian Expression, AAVpAAVHA...Ting pAAV-β2AR-NNES-NanoLuc-eLOV-TEVcs-Flag-Gal4-V5β2AR-NNES-NanoLuc-eLOV-TEVcs-Flag-Gal4-V5 (Synthetic)Mammalian Expression, AAVpAAVFlag...-15aa linker-βarrestin2-HA-GS linker-TEVpNanoLuc-15aa linker-βarrestin2-HA-GS linker-TEVp (Synthetic)Mammalian Expression, AAVpAAVHA Ting...-15aa linker-βarrestin2-no HA-GS linker-TEVpNanoLuc-15aa linker-βarrestin2-no HA-GS linker-TEVp (Synthetic)Mammalian Expression, AAVpAAV...
  6. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    Updated
    Nov. 24, 2019, 5:20 p.m.
    ...The CRISPaint toolkit includes several donor plasmids for protein tagging, including luciferase (NanoLuc), fluorescent proteins (TagGFP2, TagBFP, TagRFP...
  7. Brain Initiative Plasmid Collection

    Type
    Collection
    ...-EYFPfusion protein of NanoLuc, Volvox channelrhodopsin-1, and enhanced yellow fluorescent protein for bioluminescent optogenetics Hochgeschwender...channelrhodopsin-2, and enhanced yellow fluorescent protein for bioluminescent optogenetics Hochgeschwender 114112pcDNA3.1-CAG-NanoLuc-VChR1...
  8. Synthetic Biology - Browse Plasmids

    Type
    Collection
    ...(NL3), constiutive NanoLuc, pNBU2 backbone, AmpRdCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides...(NL1), constiutive NanoLuc, pNBU2 backbone, AmpRdCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides...(NL2), constiutive NanoLuc, pNBU2 backbone, AmpRdCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides...(NL4), constiutive NanoLuc, pNBU2 backbone, AmpRdCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides..., pNBU2 backbone, AmpRdCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron,...pMM553NanoLuc expressed constiutively from PBT1311, pNBU2 backbone, AmpRNanoLuc Lu Programming a Human Commensal Bacterium,...pMM555NanoLuc expressed constiutively from PcfxA, pNBU2 backbone, AmpRNanoLucBacterial Expression Lu Programming a Human Commensal...
  9. CRISPR Plasmids - Validated gRNAs

    Type
    Collection
    ...Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 pMM725dCas9, LacI, sgRNA, NanoLuc...Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 pMM731dCas9, LacI, sgRNA, NanoLuc...Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 pMM732dCas9, LacI, sgRNA, NanoLuc...Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 pMM733dCas9, LacI, sgRNA, NanoLuc...Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 pMM750dCas9, LacI, sgRNA, NanoLuc...
Showing: 1 - 11 of 11 results