Skip to main content
Addgene
Showing: 1 - 10 of 10 results
  1. Technologies Enabled by NanoLuc® Luciferase

    Type
    Blog Post
    ...codon-optimized Firefly luciferase genes (e.g., luc2), and NanoLuc® Luciferase are available from the repository. ...Afterall, isn’t science better when we share? NanoLuc® Luciferase-based tools are fantastic examples ... can accelerate your research. The creation of NanoLuc® Luciferase from a rather dull 19kDa Oplophorus...fluorescent proteins to make better biosensors. NanoLuc®-fluorescent protein fusions for imaging Fluorescent...administration of the furimazine substrate for NanoLuc luciferase. Both GpNLuc and OgNLuc BRET reporters...the authors noted how CyOFP1 could be excited by NanoLuc® luciferase (NLuc) and set about to create an in...cellular proteins. BRET-based biosensors utilizing NanoLuc® luciferase Many intracellular sensors of events...
  2. Luciferase Plasmid Collection

    Type
    Collection
    ...Ferrer 87067 pcDNA3.1-ccdB-Nanoluc NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Taipale 87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning... Taipale 87078 pLenti6.2-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Oskar Laur 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...interactions. NanoLuc® complementation : Protein-protein assays based on a split NanoLuc® have been used...141285 pGWB401NL3F10H NanoLuc® Creation of C-terminal luciferase fusions (NanoLuc-3xFLAG-10xHis) using ...Javier Alcudia 113442 pcDNA3.1 NL NanoLuc® CMV Mammalian expression of Nanoluc with a N-terminal Myc tag Erich...
  3. Validated gRNA Sequences

    Type
    Collection
    ...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...
  4. Hot Plasmids: Winter 2025

    Type
    Blog Post
    ...biosensor consists of a YFP-tagged G protein and a NanoLuc® (Nluc) Luciferase-fused detector that specifically...
Showing: 1 - 10 of 10 results