Skip to main content
Addgene

We narrowed to 14 results for: pyogenes Cas9

Showing: 1 - 14 of 14 results
  1. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... plasmid contains Cas9 and if so, which function of Cas9. We have plasmids with Cas9 that can cut, activate... Co-expressed Cas9 Cas9 System Selection PI pCRISPR 42875 Bacteria BsaI none S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...cut S. pyogenes mCherry Kuhn pU6-(BbsI)_CBh-Cas9-T2A-BFP 64323 Mammalian BbsI yes, cut S. pyogenes BFP Kuhn...meningitidis Joung Cas9 sgRNA vector 68463 Mammalian U6 none S. pyogenes Zhang Cas9/pTREX-n 68708 Other/... S. pyogenes Luikart pRubiG-T2A-Cas9 75348 Mammalian/Retroviral from pXL yes, activate S. pyogenes EGFP...none S. pyogenes Zhang pSpCas9n(BB)-2A-Puro (PX462) V2.0 62987 Mammalian BbsI yes, nick S. pyogenes Puro ...
  2. CRISPR Plasmids - Plants

    Type
    Collection
    ...-expressed Cas9 Cas9 System Selection PI 46968 pICSL01009::AtU6p aU6 BsaI none S. pyogenes Kamoun 52255... template none S. pyogenes Sheen 51295 pRGEB31 rice snoRNA U3 BsaI none S. pyogenes Yang 50579 pBUN6A11...yes, activate S. pyogenes Bar Chen 50580 pBUN6I11 OsU3 BsaI yes, interfere S. pyogenes Bar Chen 50582 pBUN501...BsaI yes, nick S. pyogenes Bar Chen 50594 pCBC-MT2T3 see paper BsaI none S. pyogenes Chen 50595 pCBC-MT3T4...see paper BsaI none S. pyogenes Chen 62204 pBUN421 TaU3 BsaI yes, cut S. pyogenes Bar Chen 53063 pU3-gRNA...gRNA OsU3 AarI none S. pyogenes Gao 53061 pZmU3-gRNA maize U3 none S. pyogenes Gao 53062 pU6-gRNA wheat...wheat U6 BbsI none S. pyogenes Gao 59188 pBlu/gRNA Arabidopsis U6 BbsI none S. pyogenes Stupar 62200 pBUE411...
  3. Validated gRNA Sequences

    Type
    Collection
    ... your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this gRNA sequence designed...Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531...activate S. pyogenes 26352799 Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050...41818 cut S. pyogenes 23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569... cut S. pyogenes 26472758 Sabatini AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes 23287722... cut S. pyogenes 25739462 Jiang ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut S. pyogenes 25352017... cut S. pyogenes 25352017 Zaratiegui ade6+ S. pombe TCTATTGTTCAGATGCCTCG 52225 cut S. pyogenes 25352017...
  4. CRISPR Plasmids - Xenopus

    Type
    Collection
    ...Delivery Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM = NGG) 51306 pUC57-Simple-gRNA...designed for use in Xenopus. Cut Fully functional Cas9 enzymes designed to introduce a double-strand break...surrounding the DSB is introduced along with the Cas9 and gRNA plasmids, the cell may instead repair the...backbone T7 BsaI In vitro transcription none, need Cas9 plasmid Chen Do you have suggestions for other plasmids...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...
  5. CRISPR Plasmids - Zebrafish

    Type
    Collection
    ...Delivery Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM = NGG) 46759 pT7-gRNA ...none, need Cas9 plasmid Chen and Wente 42250 DR274 T7 BsaI In vitro transcription none, need Cas9 plasmid...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...
  6. CRISPR References and Information

    Type
    Collection
    ... sites for S. pyogenes Cas9, S. aureus Cas9, S. thermophilus Cas9, N. meningitidis Cas9, or Cas12a from...vectors using ssDNA oligos p201G Cas9 ; p201B Cas9 ; p201H Cas9 ; p201N Cas9 ; pUC gRNA Shuttle PDF, 500 KB...CRISPR RNA array: Cas9 (pX260) or Cas9 D10A (pX334) ; tracrRNA: Cas9 (pX330) or Cas9 D10A (pX335) PDF,...binding and can work for S. pyogenes , S. thermophilus , or N. meningitidis Cas9 PAMs. Currently supports...118 KB Church gRNA design and cloning for Cas9 orthologs Cas9 plasmids PDF, 107 KB Chen and Wente Zebrafish...vitro transcription, injection gRNA core ; Cas9 ; optimized Cas9 PDF, 66.8 KB Fujii gRNA design and cloning... Injection and selection for Cas9-triggered homologous recombination Cas9-sgRNA target construct ; pMA122...
  7. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM = NGG) 47549 pDD162 (Peft-3::Cas9 + Empty ...need Cas9 plasmid Joung 46170 PU6::klp-12_sgRNA cU6 PCR (see paper) Transfection none, need Cas9 plasmid... none, need Cas9 plasmid Boxem 47941 pMB60 T7 BsaI In vitro transcription none, need Cas9 plasmid Boxem...sgRNA-scaffold SP6 AflII In vitro transcription none, need Cas9 plasmid Sternberg 177783 L4440_BioBrick-sgRNA T7...T7 BbsI, BsaI Ingestion by C. elegans none, need Cas9 plasmid Ristow Do you have suggestions for other...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator peptide can...
  8. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...Delivery Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM = NGG) 49410 pCFD3-dU6...transcription Virmilion none, need Cas9 plasmid Bullock and Port 49330 pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin..., need Cas9 plasmid Bullock and Port 51026 U6-BbsI-crRNA dU6 BbsI Transfection none, need Cas9 plasmid...Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse transcriptase (...Injection or in vitro transcription Virmilion none, need Cas9 plasmid Bullock and Port 49411 pCFD4-U6:1_U6:3tandemgRNAs...pU6-BbsI-chiRNA dU6 BbsI Transfection none, need Cas9 plasmid O'Connor-Giles , Harrison , Wildonger 49408...Injection or in vitro transcription Virmilion none, need Cas9 plasmid Bullock and Port 49409 pCFD2-dU6:2gRNA dU6...
  9. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...off-target effect. Which species or variant of Cas9 ( S. pyogenes , S. aureus etc.) was this gRNA sequence ...species or PAM binding variant of Cas9. For instance, wild-type SpCas9 must be used with targets that are...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...
  10. Zhang Lab CRISPR Page

    Type
    Collection
    ...vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express SpCas9, and another to express...mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9) nuclease along with the guide RNA. For ...Return to top Cas9 SAM transcriptional activation plasmids and screening library CRISPR/Cas9 Synergistic...of cells and nuclei. Return to top AAV - Cas9 mouse CRISPR-Cas9 is a versatile genome editing technology...constitutively expressing Cas9 knockin mice (Platt et al ., Cell 2014). In these mice the CRISPR-Cas9 system can be...constitutively Cas9-expressing mouse. Described here are AAV vectors that can be combined with Cas9 in a wide...are below. The Cas9 knockin mouse can be purchased from Jackson Labs: Cre-dependent Cas9 mouse Constitutively...
  11. CRISPR Plasmids - Yeast

    Type
    Collection
    ... In Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM = NGG) 49014 pRPR1_gRNA... Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify a region of genomic DNA...immunoprecipitate FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9 to a specific locus, avoiding...handle_RPR1t pRPR1 HindIII S. cerevisiae LEU2 none, need Cas9 plasmid Lu Do you have suggestions for other plasmids...PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional repressor peptide...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein becomes a ...
  12. Lentiviral Prep Service

    Type
    Collection
    ... 52962 lentiCas9-Blast Sp Cas9 Cut Blasticidin Expresses human codon-optimized S. pyogenes Cas9 protein...Root Cas9 Lentivirus Cas9 viruses can be used to interrogate the genome in a variety of ways. Cas9 proteins...backbone. Zhang Cas9 and Accessories for Activating Gene Expression Catalytically-dead Cas9 (dCas9) can be fused...plasmids resource page . Cas9 for Editing Genomic Sequences To perform genome edits, Cas9 nuclease is used to...Browse In-Stock Lentivirus Pooled CRISPR Libraries Cas9 Pooled Barcoding Libraries Control Addgene's lentiviruses...Resistance Activity PI 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A ...-targeting controls. This backbone contains SpCas9. SpCas9 and 76,441 unique sgRNAs targeting 19,114 human...
  13. CRISPR Plasmids - Bacteria

    Type
    Collection
    ... In Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM = NGG) 42875 pCRISPR BsaI... Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify a region of genomic DNA...immunoprecipitate FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9 to a specific locus, avoiding... pneumoniae Kanamycin none, need Cas9 plasmid Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae Chloramphenicol...Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse transcriptase (...crRNA. This activity provides a stark contrast to Cas9 and Cpf1, which require that each DNA target have... BBa_J23119 SpeI + HindIII Ampicillin none, need Cas9 plasmid Qi Do you have suggestions for other plasmids...
  14. CRISPR Guide

    Type
    Collection
    ...Plasmids: Purify Cas9 Alternatives for CRISPR Genome Engineering S. pyogenes Cas9 (SpCas9) is the most commonly... available with multiple Cas9 variants, including high fidelity Cas9s, Cas9s with various PAM requirements...strand SpCas9-HF1 - disrupt Cas9’s interactions with DNA phosphate backbone HypaCas9 - increase Cas9 proofreading...Species/Variant of Cas9 PAM Sequence* Streptococcus pyogenes (SP); SpCas9 3' NGG SpCas9 D1135E variant 3...design, engineered Cas9s can enhance CRISPR specificity. SpCas9 (from Streptococcus pyogenes ) is the most ...new tools. Figure 3: Overview of Cas9n Nickase and dead Cas9 The two Cas9 nuclease domains, RuvC and HNH...enhanced specificity by engineering Cas9 into high fidelity Cas9s (hfCas9) . There is currently no defined...
Showing: 1 - 14 of 14 results