We narrowed to 17 results for: tet off
-
TypeCollection...shown. Tetracycline Off (Tet-Off) The first major advance was the Tet-Off system. A tetracycline-controlled... of tet-responsive systems: Tet-Off and Tet-On. Read on to learn more about the components of tet systems... center: Tet-Off; right: Tet-On. TRE: Tet response element; tTA: tetracycline-controlled transactivator...active and only turned off occasionally, use Tet-Off: express a tTA and include a tet-responsive promoter...promoter, for Tet-Off. See Plasmid #27106 for rtTA. tTA Edward Hsiao 99118 pAAV-CAG-tTA AAV Tet-Off vector, ... CAG promoter for Tet-Off tTA-Advanced Takeshi Imai 104109 pAAV-Syn1-tTA AAV Tet-Off vector, expressed...can serve as either Tet-Off or Tet-On systems, depending on whether they are used alongside a tTA or rtTA...
-
AAV Molecular Tools
TypeCollection...available from Addgene's viral service encoding tet-off transactivators and tools for affinity purification...pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Viviana Gradinaru 99120 ...Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback loop...promoter (ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback loop...tools/controls and tetracycline transactivators that can be used with tetracycline (tet)-inducible expression...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1...Overexpression Tracers Tetracycline Transactivators and Inducible Tools These AAV encode tetracycline-inducible tools... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible ...vector for mammalian genome editing Tet-pLKO-puro and Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression...Expresses ultraID in mammalian cells with the Tet-On or Tet-Off system Return to top Selectable Markers Regardless...Backbones Neomycin (G418) Mammalian, Varies Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression Find...Pur - Eukaryotic expression vector Tet-pLKO-puro - Tet-inducible lentiviral shRNA expression...expression vector with N-terminal HA tag pInducer20 - Tet-inducible HA-tagged lentiviral vector for ORF expression...vector for gene expression pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination vector for... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Return to top Reversibly Photoswitchable (e.g. Off to On to Off) Protein Excitation (nm) Emission (nm) Activation...Structure Plasmids rsTagRFP 567 585 440 (Off to On) 567 (On to Off) 4.0 6.6 43 min Prone to dimerization ...Bacterial Expression iLOV 447 497 467 (On to Off) Spontaneous (Off to On) Monomer pEiLOV-N1 - Mammalian Expression...Mammalian Expression rsEGFP2 478 503 408 (Off to On) 503 (On to Off) 18 5.8 20 min pcDuex2-rsEGFP2-E - Mammalian...Bacterial Expression rsEGFP1 493 510 405 (Off to On) 491 (On to Off) 17 6.5 3 h rsGFP1-pBAD - Bacterial Expression...Expression Dronpa3 490 515 405 (Off to On) 490 (On to Off) 19 Monomer Dronpa3-N1 - Mammalian Expression...Mammalian Expression Dronpa 503 518 400 (Off to On) 503 (On to Off) 81 40 min Monomer pcDuex2-Dronpa - Mammalian... -
CRISPR Guide
TypeCollection...increase specificity, and decrease off-target effects Sniper-Cas9 - less off-target activity; compatible with...cleaving only one strand of target dsDNA. Off-target effects or off-target activity Cas9 cleavage at undesired...of partial homology throughout the genome, called off-targets, that can impact your experiment. There are...DSB within the target DNA, it’s unlikely that two off-target nicks will be generated close enough to cause... mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...method, increased fidelity enzymes generate less off-target editing than wild type Cas9. Examples of increased...proofreading and discrimination evoCas9 - decrease off-target effects xCas9 3.7 - mutations in multiple ... -
Neurodegeneration Research Collection
TypeCollection... bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression of transcription factors for...progression of Huntington’s disease. The foundation offers curated information on tools and reagents (Link... -
Validated gRNA Sequences
TypeCollection...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter... 26627737 Moffat PSMD1 H. sapiens TGTGCGCTACGGAGCTGCAA 74180 cut S. pyogenes 26627737 Moffat PSMD1 H. ... 26627737 Moffat PSMB2 H. sapiens ATGTTCTTGTCGCCTCCGAC 74184 cut S. pyogenes 26627737 Moffat PSMB2 H. ... 26627737 Moffat EIF3D H. sapiens TGTAGGTTGCCTCCATGGCC 74187 cut S. pyogenes 26627737 Moffat EIF3D H. ...pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737 Moffat AMPK alpha 1...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...Cre-lox can be used to turn shRNA constructs on or off. In floxed-shRNA constructs, Cre can excise the shRNA...utilize recombination elements such as Cre to turn off the expression of one gene while simultaneously turning...with lineage-specific drivers can also help reduce off-target events and the systemic effects of Cre toxicity...only activated in the presence of tamoxifen. A tetracycline-regulated or other drug-inducible approach may... -
Luciferase Plasmid Collection
TypeCollection...Luciferase Firefly TRE Lentiviral vector with dox- or tet-inducible luciferase expression Stephen Tapscott ...popular plasmids expressing luciferase. We also offer ready-to-use AAV preparations of select luciferase...expression of firefly luciferase William Kaelin 60495 pSBtet-GP Firefly TRE Dox-inducible expression of firefly... -
Bacterial Expression Systems
TypeCollection...Controlled Expression Resources Check out our Tetracycline (Tet) Inducible Expression Collection for an extensive...Expression Species PI 44249 pdCas9-bacteria pTetO Anhydrotetracycline (aTc) Escherichia coli Stanley Qi 11518...coli Andreas Moeglich 68940 pRMC2 Pxyl/TetO Anhydrotetracycline (aTc) Staphylococcus aureus Tim Foster...glutamicum Timothy Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...tuberculosis Sabine Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...extorquens Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline (aTc) Methylobacterium extorquens Christopher...baumannii Jason Peters 127088 pMS17 tcp830 Anhydrotetracycline (aTc) Streptomyces sp. Maggie Smith 74065... -
CRISPR Plasmids - Bacteria
TypeCollection...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ...Publication 64325 3xFLAG-dCas9/p-bacteria 3xFLAG-dCas9 pLtetO-1 Fujii Efficient isolation of specific genomic... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ... by DNMT3A or MQ1, and cytosine demethylation by Tet1. These modifications persist over time and are potentially... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... Wheeldon FgH1tUTG 70183 Mammalian/Lentiviral H1-Tet none S. pyogenes Herold lentiGuide-Crimson 70683 ...Zhang pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA 73796 Yeast pRPR1(TetO) yes, interfere S. pyogenes... 65006 Bacteria BsaI yes, interfere S. pyogenes Koffas BPK764 65767 Bacteria BsaI yes, cut S. pyogenes...yes, nick S. pyogenes Duchek pAC5-dual-dCas9VP48-sgTetO 48237 Mammalian BbsI yes, activate S. pyogenes ...Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...62315 Yeast none S. pyogenes URA3 Lim, Qi pRPR1(1xTetO)_gRNA_handle_RPR1t 62966 Yeast HindIII none S. ... Mammalian/Lentiviral hU6 none S. pyogenes Puro Moffat lenti sgRNA(MS2)_puro backbone 73795 Mammalian/... -
Genetic Code Expansion
TypeCollection...are several things to consider. If you are working off of a previously established protocol, make sure to...Ryan Mehl 85496 pDule-Tet2.0 Tetrazine2.0 tRNA synthetase M. jannaschii Tetrazine 2.0 Bacterial TAG Ryan...Ryan Mehl 85497 pDule2-Tet2.0 Tetrazine2.0 tRNA synthetas M. jannaschii Tetrazine 2.0 Bacterial TAG Ryan...Bacterial TAG Ryan Mehl 164580 pUltraI-Tet3.0[TAA] Tet3.0RS M. barkeri Tet3.0 Bacterial TAA Ryan Mehl 172482 ...TAG Ryan Mehl 174080 pDule-Tet3.0 Tet3.0 tRNA synthetase M. barkeri Tetrazine 3.0 Bacterial TAG Ryan Mehl...NES-Flag-R2-84-MbRS Tetrazine3.0 NES-Flag-R2-84 tRNA synthetase M. barkeri Tetrazine 3.0 Mammalian Ryan...aminoacyl-tRNA synthetase M. jannaschii 1,2,4,5-tetrazine ncAAs Bacterial TAG Ryan Mehl 217361 pIDTSmart-MbPylRS... -
Fluorescent Protein Guide: Biosensors
TypeCollection... tension sensor modules Grashoff Lab Tension Sensor Plasmids Carsten Grashoff Tension tCRMod tension sensors...the plasmids associated with the article. We also offer ready-to-use AAV preparations of select plasmids...sensors, ER-targeted CEPIA1er ER-mitochondria tethering by PDZD8 regulates Ca(2+) dynamics in mammalian...Yulong Li ADP Biosensor for ADP based on tetramethylrhodamine-labeled ParM A fluorescent, reagentless ...reagentless biosensor for ADP based on tetramethylrhodamine-labeled ParM. ACS Chem Biol. 2010 Apr 16;5(4):415-25...single cells. Angew Chem Int Ed Engl. 2018 Jun 27. Tetsuya Kitaguchi ATP Variants of ATP sensor iATPSnFR1.0...dual-color imaging. PLoS One. 2014 Jun 24;9(6):e100252. Tetsuya Kitaguchi cAMP (cyclic AMP) Red fluorescent protein-based... -
Deisseroth INTRSECT Collection
TypeCollection... 55651 pAAV-hSyn Con/Foff EYFP Cre AND NOT Flp F3/F5 No 137162 pAAV-Ef1a-Con/Foff 2.0-EYFP Cre AND NOT.../F5 Yes 55652 pAAV-hSyn Coff/Fon EYFP Flp AND NOT Cre No 231927 pAAV-Ef1a-Coff/Fon-EYFP Flp AND NOT Cre...137130 pAAV-Ef1a-Con/Foff 2.0-BFP Cre AND NOT Flp FRT/F5 Yes 137131 pAAV-Ef1a-Coff/Fon-BFP Flp AND NOT ...137133 pAAV-Ef1a-Con/Foff 2.0-mCherry Cre AND NOT Flp FRT/F5 Yes 137134 pAAV-Ef1a-Coff/Fon-mCherry Flp AND...137137 pAAV-Ef1a-Con/Foff 2.0-oScarlet Cre AND NOT Flp FRT/F5 Yes 137138 pAAV-Ef1a-Coff/Fon-oScarlet Flp ...137120 pAAV-Ef1a-Con/Foff 2.0-GCaMP6M Cre AND NOT Flp FRT/F5 Yes 137121 pAAV-Ef1a-Coff/Fon-GCaMP6M Flp AND...137123 pAAV-Ef1a-Con/Foff 2.0-GCaMP6F Cre AND NOT Flp FRT/F5 Yes 137124 pAAV-Ef1a-Coff/Fon-GCaMP6F Flp AND... -
Neurodegeneration Plasmid Collection
TypeCollection...188572 Tet-off TauRD (P301L/V337M) MAPT Myc TRE Parkinson's, FTD Franz-Ulrich Hartl 188573 Tet-off Full ...Ataxia Richard Youle 176485 Piggybac-TetO-hNurr1-blast NR4A2 TetO Parkinson's Marius Wernig 176852 UBQLN2...Ronald Hart 190811 pTet-O-APOE-E2-T2A-Puro APOE UbC Alzheimer's Ronald Hart 190812 pTet-O-APOE-E3-T2A-Puro...Flag, GFP CMV ALS Tanja Mittag 234848 pLV.tetO.Nurr1 NR4A2 TetON Parkinson's Malin Parmar 234872 PGK-HA-PGRN... CMV Ataxia telangiectasia Stephen Elledge 43918 tetO-ALN NR4A2 His, V5 TRE Parkinson's John Gearhart ...T2A-Puro APOE UbC Alzheimer's Ronald Hart 190813 pTet-O-APOE-E4-T2A-Puro APOE UbC Alzheimer's Ronald Hart ...Lukas Trantirek 232478 pB-TR-hSOD1 SOD1 Flag CMV-TetO ALS Lukas Trantirek 232481 pHLsec hSOD1 SOD1 Flag...