We narrowed to 18 results for: tet off
-
TypeCollection...Collections Tetracycline (Tet) Inducible Expression Tetracycline (Tet) Inducible Expression Additional Resources...Collections Background Tetracycline Off Tetracycline On Experimental Tips Tet Plasmids Background To advance the...developed is known as tetracycline off: in the presence of tetracycline, expression from a tet-inducible promoter...Description Co-expressed tTA, rtTA, or TetR On or Off PI 21916 Tet-pLKO-neo 3rd generation lentiviral plasmid...Bujard tested the tet system in a mammalian cell system (HeLa) and found that the tet system was functional...Tips Choosing a tet system If your gene of interest should be active, and only turned off occasionally, ...Either Vogelstein 100521 pCW57.1-MAT2A Lentiviral Tet-Off all in one plasmid derived from pCW57.1. rtTA was...
-
AAV Molecular Tools
TypeCollection...available from Addgene's viral service encoding tet-off transactivators and tools for affinity purification...pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1...Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback loop...promoter (ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback loop...can be used with tetracycline (tet)-inducible expression systems . ID Name Expression System Activity ...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1...Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators... -
Cre-lox system
TypeCollection... pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV Mammalian Sauer 11961 pBS596 tet-hCMV-GFPcre...none Mammalian Sauer 11957 pBS595 tet-hCMV-EGFPcre Cre-EGFP fusion Tet inducible Mammalian Sauer 11958 ... which reporters are initially OFF and then probabilistically ON or OFF following Cre recombination to...Supernova TRE AAV Iwasato 85577 pTC-CMV-Tet CreER expression and tetracyclin-dependent transgene/shRNA expression...ApoE.HCR.hAAT Mammalian Ehmer 85578 pTC-ApoE-Tet CreER expression and tetracyclin-dependent transgene/shRNA expression...tet-hCMV-GFPcre tet inducible Cre-GFP fusion, metallothionein MT-I region including the polyadenylation site and...and several introns tet-hCMV Mammalian Sauer 12168 pMB80 (R26-CreER) Cre-ERT2 with loxp cassette; Targeting... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible ...vector for mammalian genome editing Tet-pLKO-puro and Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression...Expresses ultraID in mammalian cells with the Tet-On or Tet-Off system Return to top Selectable Markers Regardless...Backbones Neomycin (G418) Mammalian, Varies Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression Find...Neomycin selection Puromycin Mammalian Tet-pLKO-puro - Tet-inducible lentiviral shRNA expression...vector with N- or C-terminal HA tag pInducer20 - Tet-inducible HA-tagged lentiviral vector for ORF expression...vector for gene expression pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination vector for... -
Plan Your Experiment
TypeCollection...sites are called off-targets and should be examined during gRNA design. In general, off-target sites are...reagents may be more appropriate. In cases where off-target editing is a major concern, Cas9-gRNA ribonucleoprotein... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...window of CRISPR component expression may decrease off-target effects Can be used to generate transgenic...components Short window of CRISPR activity may decrease off-target effects Additional Resources: CRISPR protocols...nearby. Select gRNAs based on predicted on-target and off-target activity A PAM sequence is absolutely necessary...using a high-fidelity Cas enzyme. In addition to off-target activity , it is also important to consider... -
CRISPR Guide
TypeCollection...increase specificity, and decrease off-target effects Sniper-Cas9 - less off-target activity; compatible with...cleaving only one strand of target dsDNA. Off-target effects or off-target activity Cas9 cleavage at undesired...of partial homology throughout the genome, called off-targets, that can impact your experiment. There are...DSB within the target DNA, it’s unlikely that two off-target nicks will be generated close enough to cause... mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...method, increased fidelity enzymes generate less off-target editing than wild type Cas9. Examples of increased...proofreading and discrimination evoCas9 - decrease off-target effects xCas9 3.7 - mutations in multiple ... -
Neurodegeneration Research Collection
TypeCollection... bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression of transcription factors for...progression of Huntington’s disease. The foundation offers curated information on tools and reagents (Link... -
Validated gRNA Sequences
TypeCollection...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter... 26627737 Moffat PSMD1 H. sapiens TGTGCGCTACGGAGCTGCAA 74180 cut S. pyogenes 26627737 Moffat PSMD1 H. ... 26627737 Moffat PSMB2 H. sapiens ATGTTCTTGTCGCCTCCGAC 74184 cut S. pyogenes 26627737 Moffat PSMB2 H. ... 26627737 Moffat EIF3D H. sapiens TGTAGGTTGCCTCCATGGCC 74187 cut S. pyogenes 26627737 Moffat EIF3D H. ...pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737 Moffat AMPK alpha 1...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Expression Jump to Top Photoswitchable (e.g. off to on to off) Protein Excitation (nm) Emission (nm) Brightness...Mammalian Expression Jump to Top Photoactivatable (e.g. off to on) Excitation and Emission wavelengths after ...eqFP611 559 611 35 Tetramer eqFP611-N1 - Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian...CYPet-C1 - Mammalian Expression AmCyan1 453 486 11 Tetramer AmCyan1-N1 - Mammalian Expression MiCy (Midoriishi-Cyan...Expression (cysteine-free SGFP2) ZsGreen 493 505 39 Tetramer pHIV-Zsgreen - Mammalian Expression (this is a...YPet-pBAD - Bacterial Expression ZsYellow1 529 539 8 Tetramer ZsYellow1-N1 - Mammalian Expression mPapaya1 530...Expression Kaede 508 / 572 518 / 580 87 / 20 5.6/5.6 Tetramer Kaede-N1 - Mammalian Expression Kaede-C2 - Mammalian... -
CRISPR Plasmids - Bacteria
TypeCollection...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ...Publication 64325 3xFLAG-dCas9/p-bacteria 3xFLAG-dCas9 pLtetO-1 Fujii Efficient isolation of specific genomic... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...NHEJ). Double nicking strategies reduce unwanted off-target effects. Nickase mutants can also be used ... by DNMT3A or MQ1, and cytosine demethylation by Tet1. These modifications persist over time and are potentially... -
Bacterial Expression Systems
TypeCollection...PR, pLtetO, pLlacO Arabinose, Anhydrotetracycline, lactose, IPTG Richard Murray Plasmids based off of ... pdCas9-bacteria 44249 pTetO Anhydrotetracycline Stanley Qi Anhydrotetracycline inducible expression of... light. pCph8 50552 pLtetO-1 Anhydrotetracycline Jeffrey Tabor Anhydrotetracycline inducible expression...pwtCas9-bacteria 44250 CRISPR Stanley Qi Anhydrotetracycline inducible expression of wild-type Cas9 from... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... Wheeldon FgH1tUTG 70183 Mammalian/Lentiviral H1-Tet none S. pyogenes Herold lentiGuide-Crimson 70683 ...Zhang pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA 73796 Yeast pRPR1(TetO) yes, interfere S. pyogenes... 65006 Bacteria BsaI yes, interfere S. pyogenes Koffas BPK764 65767 Bacteria BsaI yes, cut S. pyogenes...yes, nick S. pyogenes Duchek pAC5-dual-dCas9VP48-sgTetO 48237 Mammalian BbsI yes, activate S. pyogenes ...Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...62315 Yeast none S. pyogenes URA3 Lim, Qi pRPR1(1xTetO)_gRNA_handle_RPR1t 62966 Yeast HindIII none S. ... Mammalian/Lentiviral hU6 none S. pyogenes Puro Moffat lenti sgRNA(MS2)_puro backbone 73795 Mammalian/... -
Genetic Code Expansion
TypeCollection...are several things to consider. If you are working off of a previously established protocol, make sure to...Ryan Mehl 85496 pDule-Tet2.0 Tetrazine2.0 tRNA synthetase M. jannaschii Tetrazine 2.0 Bacterial TAG Ryan...Ryan Mehl 85497 pDule2-Tet2.0 Tetrazine2.0 tRNA synthetas M. jannaschii Tetrazine 2.0 Bacterial TAG Ryan...Bacterial TAG Ryan Mehl 164580 pUltraI-Tet3.0[TAA] Tet3.0RS M. barkeri Tet3.0 Bacterial TAA Ryan Mehl 172482 ...TAG Ryan Mehl 174080 pDule-Tet3.0 Tet3.0 tRNA synthetase M. barkeri Tetrazine 3.0 Bacterial TAG Ryan Mehl...NES-Flag-R2-84-MbRS Tetrazine3.0 NES-Flag-R2-84 tRNA synthetase M. barkeri Tetrazine 3.0 Mammalian Ryan...aminoacyl-tRNA synthetase M. jannaschii 1,2,4,5-tetrazine ncAAs Bacterial TAG Ryan Mehl 217361 pIDTSmart-MbPylRS... -
Fluorescent Protein Guide: Biosensors
TypeCollection... tension sensor modules Grashoff Lab Tension Sensor Plasmids Carsten Grashoff Tension tCRMod tension sensors...the plasmids associated with the article. We also offer ready-to-use AAV preparations of select plasmids...sensors, ER-targeted CEPIA1er ER-mitochondria tethering by PDZD8 regulates Ca(2+) dynamics in mammalian..., reagentless biosensor for ADP based on tetramethylrhodamine-labeled ParM A fluorescent, reagentless ...reagentless biosensor for ADP based on tetramethylrhodamine-labeled ParM. ACS Chem Biol. 2010 Apr 16;5(4):415-25...single cells. Angew Chem Int Ed Engl. 2018 Jun 27. Tetsuya Kitaguchi ATP Variants of ATP sensor iATPSnFR1.0...dual-color imaging. PLoS One. 2014 Jun 24;9(6):e100252. Tetsuya Kitaguchi cAMP (cyclic AMP) Red fluorescent protein-based... -
Deisseroth INTRSECT Collection
TypeCollection... 55651 pAAV-hSyn Con/Foff EYFP Cre AND NOT Flp F3/F5 No 137162 pAAV-Ef1a-Con/Foff 2.0-EYFP Cre AND NOT.../F5 Yes 55652 pAAV-hSyn Coff/Fon EYFP Flp AND NOT Cre No 231927 pAAV-Ef1a-Coff/Fon-EYFP Flp AND NOT Cre...137130 pAAV-Ef1a-Con/Foff 2.0-BFP Cre AND NOT Flp FRT/F5 Yes 137131 pAAV-Ef1a-Coff/Fon-BFP Flp AND NOT ...137133 pAAV-Ef1a-Con/Foff 2.0-mCherry Cre AND NOT Flp FRT/F5 Yes 137134 pAAV-Ef1a-Coff/Fon-mCherry Flp AND...137137 pAAV-Ef1a-Con/Foff 2.0-oScarlet Cre AND NOT Flp FRT/F5 Yes 137138 pAAV-Ef1a-Coff/Fon-oScarlet Flp ...137120 pAAV-Ef1a-Con/Foff 2.0-GCaMP6M Cre AND NOT Flp FRT/F5 Yes 137121 pAAV-Ef1a-Coff/Fon-GCaMP6M Flp AND...137123 pAAV-Ef1a-Con/Foff 2.0-GCaMP6F Cre AND NOT Flp FRT/F5 Yes 137124 pAAV-Ef1a-Coff/Fon-GCaMP6F Flp AND... -
Neurodegeneration Plasmid Collection
TypeCollection...188572 Tet-off TauRD (P301L/V337M) MAPT Myc TRE Parkinson's, FTD Franz-Ulrich Hartl 188573 Tet-off Full ...Ataxia Richard Youle 176485 Piggybac-TetO-hNurr1-blast NR4A2 TetO Parkinson's Marius Wernig 176852 UBQLN2...Ronald Hart 190811 pTet-O-APOE-E2-T2A-Puro APOE UbC Alzheimer's Ronald Hart 190812 pTet-O-APOE-E3-T2A-Puro... CMV Ataxia telangiectasia Stephen Elledge 43918 tetO-ALN NR4A2 His, V5 TRE Parkinson's John Gearhart ...T2A-Puro APOE UbC Alzheimer's Ronald Hart 190813 pTet-O-APOE-E4-T2A-Puro APOE UbC Alzheimer's Ronald Hart ... -
Luciferase Plasmid Collection
TypeCollection...enchancer regions in Drosopholia Herman Wijnen 126033 pTETRIS-cargo Firefly For use as a reporter of the ability...to find plasmids expressing luciferase. We also offer ready-to-use AAV preparations of select luciferase...