Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 3 results for: CAG synthetic promoter

Clear keywords
Showing: 1 - 3 of 3 results

  1. Chemogenetics Guide

    Type
    Guide
    ...be activated by synthetic ligands. Specifically, Receptors Activated Solely by Synthetic Ligands (RASSLs...commercially available. Table 4: Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor... 1998). These receptors were activated by the synthetic ligand spiradoline, however, spiradoline exhibited... GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression Targeted Expression Depending ...

  2. Molecular Biology Reference

    Type
    Guide
    ...downstream from a promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA...particular plasmid. Promoter Region Drives transcription of the insert. The promoter recruits transcriptional...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...weaker promoters can direct low/endogenous expression levels. For more information about promoters, check...resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins of Molecular Genetics...code by redirecting some codons to encode for synthetic amino acids. Plasmids and Recombinant DNA Technology... for a variety of studies used to investigate promoters, small RNAs, and other genetic elements. Plasmid...

  3. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward Luc-F AGTCAAGTAACAACCGCGA...Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA...Nopaline synthase promoter Forward Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter Forward OpIE2 Forward...
Showing: 1 - 3 of 3 results