Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 6 results for: IRES-GFP

Showing: 1 - 6 of 6 results

  1. Sequencing Primers

    Type
    Guide
    ...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...

  2. Adenovirus Guide

    Type
    Guide
    ...pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest...recombinant adenoviral vector production that contain IRES-GFP. Pseudotyping The production of viral vectors ...throughout viral vector production. During experiments, GFP can be used to sort cells infected with rAdV vectors...adenoviral vector production that do not contain GFP. Recombinant adenoviral vector (rAdV) Modified form... of genetic cargo. Production of HCAdV vectors requires using an additional adenoviral helper virus (HV...

  3. Lentiviral Vector Guide

    Type
    Guide
    ...selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead of ... sorting (FACS) is used to sort cells expressing GFP and later expanded into a cell line. More information...as a promoter on the transfer plasmid, and this requires Tat for activation. Second-generation plasmids...vectors from your plasmids (Figure 5). This process requires a production cell line, typically human embryonic...

  4. Modular Cloning Guide

    Type
    Guide
    ...a combinatorial library of constructs expressing GFP at 18 levels for rapid characterization in new organisms...highly-tunable GPCR-based biosensors in yeast (requires MoClo-YTK parts for use). Yeast GoldenBraid Cloning...

  5. Molecular Biology Reference

    Type
    Guide
    ...contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic... regions of interest. In vitro DNA replication requires the 4 nucleotides, a DNA polymerase enzyme, the...tagged base is incorporated. Sanger sequencing requires a lot of DNA because the ultimate goal is to have...

  6. CRISPR Guide

    Type
    Guide
    ...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...indel formation compared to HDR. Prime editing requires more optimization and typically has lower efficiency...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...
Showing: 1 - 6 of 6 results