...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...

...pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest...vectors that contain IRES-GFP pShuttle Class of transfer vectors that do not contain GFP Additional Vocabulary...throughout virus production. During experiments, GFP can be used to sort cells infected with adenovirus...DNA viruses. They are not related; however, AAV requires the presence of adenoviral genes E1, E4, E2a and...

...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive...targeting the region where the edit should be made HDR requires a repair template and displays reduced efficiency...

...another marker, such as GFP. A researcher can use FACS to sort cells expressing GFP and later expand these...transcription of shRNAs. cDNA expression requires RNA pol II, and thus requires an RNA pol II promoter, such as...driven by the 5'LTR, which is a weak promoter and requires the presence of Tat to activate expression. The...

...contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic... regions of interest. In vitro DNA replication requires the 4 nucleotides, a DNA polymerase enzyme, the...tagged base is incorporated. Sanger sequencing requires a lot of DNA because the ultimate goal is to have...

...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...indel formation compared to HDR. Prime editing requires more optimization and typically has lower efficiency...living cells. Visualizing a specific genomic locus requires recruitment of many copies of labeled proteins...gRNAs that tile the locus. Chromosome painting requires delivery of hundreds of gRNAs with target sites...