We narrowed to 4 results for: Myc-tagged Cre

...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance...HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC...Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT...GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse...GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...

... Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST...sequence. Epitope tags, on the other hand, are commonly used in molecular cloning to tag a gene within a...CRISPR check out our CRISPR Guide . CRISPR Plasmids , Cre-lox and Other Recombinases , TALEN Plasmids and Kits...random incorporation of modified, fluorescently-tagged bases during in vitro DNA replication in addition...nucleotides. The four standard bases (dNTPs) are tagged with a different fluorophore so they can be distinguished...distinguished from one another. These tagged dNTPs also lack a binding site for the next nucleotide (denoted...because the ultimate goal is to have a fluorescently-tagged nucleotide at each position in the DNA sequence...

...loss-of-function screens, in vivo mutagenesis, pathway mapping, and drug resistance studies. Advantages Broad range...lentiviral or DNA-based screens. Created with BioRender.com. Types of Pooled Library Screens In pooled lentiviral...plasmid. Library screens can be divided into two types: positive screens and negative screens. Both types ...mechanism Negative screens are a little trickier than positive screens. In a negative screen, the goal is to...Library Screening Resources Pooled libraries represent a powerful tool for forward genetic screening or identifying...In a CRISPR screening experiment, target cells are treated with the pooled library to create a population...mutant cells that are then screened for a phenotype of interest. Screening experiments using a pooled ...

...transgene expression. Popular uses include Cre-lox mice, knockouts using CRISPR or shRNA , and overexpressing...in-stock lentiviral preps . CRISPR Genomic Screens Genome-wide screens are an efficient way to determine what...Scientific Curation team at Addgene. Media Credits Figures created with BioRender (Link opens in a new window...Uses Safety Resources Plasmid Elements Glossary Credits Lentiviruses are a type of retrovirus and belong...laboratory, and many have been removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome.... use the packaging genes gag , pol , and env to create viral particles. Wild-type lentiviruses additionally...replication-competent lentivirus production — that is, creation of viral particles that could infect cells and...