We narrowed to 3 results for: Myc-tagged Cre

1. Sequencing Primers

   Type

   Guide

   ...promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT... TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer HAT GAGGAGCACGCTCATGCCCAC...Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen) CYC1... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end...

2. Molecular Biology Reference

   Type

   Guide

   ... Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST...nucleotides. Epitope tags on the other hand are commonly used in molecular cloning to tag a gene within a ...random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition to...T, C, or G nucleotide. The 4 standard bases are tagged with a different fluorophore so they can be distinguished...when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases do not ..., the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing requires...because the ultimate goal is to have a fluorescently tagged nucleotide at each position in the DNA sequence...

3. Lentiviral Vector Guide

   Type

   Guide

   ...transgene expression. Popular uses include Cre-lox mice, knockouts using CRISPR or shRNA , and overexpressing...removed or mutated for increased safety. Figure 1: Wild-type lentivirus genome. Created with BioRender.com...in-stock lentiviral preps . CRISPR Genomic Screens Genome-wide screens are an efficient way to determine what... use the packaging genes gag , pol , and env to create viral particles. Wild-type lentiviruses additionally...replication-competent lentivirus production — that is, creation of viral particles that could infect cells and...Figure 2: First-generation lentiviral plasmids. Created with BioRender.com. Second-generation Second-generation...Figure 3: Second-generation lentiviral plasmids. Created with BioRender.com. Third-generation The third-...