Skip to main content

We narrowed to 1 result for: amh

Showing: 1 - 1 of 1 results
  1. Sequencing Primers

    Type
    Guide
    ...CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI site Forward pBRforEco AATAGGCGTATCACGAGGC In pBR322...GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit ...
Showing: 1 - 1 of 1 results