We narrowed to 10 results for: amh
-
TypeBlog Post...was digested with 2 unique enzymes (HindIII and BamHI) and run on an agarose gel. The resulting gel image...the plasmid is digested with either HindIII and BamHI alone (lanes 4-5), there is a single band of 7.3...plasmid. The double digest with both HindIII and BamHI (lane 3) produces bands at 6kb and 1.2kb (red box... star activity. Some endonucleases (for example BamHI) are capable of cleaving sequences which are similar...
-
Three Tips for Preventing Viral Plasmid Recombination in Your Samples
TypeBlog Post...recombined plasmid around 1.5 kb. When cut with BamHI, the expected linear plasmid is present, but the... -
Scientists Map the SARS-CoV-2-Human Interaction Network
TypeBlog Post...portability, all viral genes are flanked by EcoRI and BamHI restriction sites - so cloning projects should be... -
Addgene: The First Twenty Years
TypeBlog Post...guide: https://www.addgene.org/guides/crispr/” — SirHamhands, responding to a request for “any suggestion ... -
MXS Chaining
TypeBlog Post...SpeI and XbaI EcoRI and PstI Bglbricks BglII and BamHI EcoRI Additional Resources on the Addgene Blog... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...pHKMC1: Empty sgRNA for Cloning 67720 Worm NotI/BamHI none S. pyogenes Colaiacovo pRB17 52527 Fly blunt...pyogenes Zack pHL-H1-ccdB-mEF1a-RiH 60601 Mammalian BamHI/EcoRI none S. pyogenes Hygro Hotta pUC-H1-gRNA 61089...pyogenes Musunuru pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI) 64217 Mammalian BbsI yes, cut S. pyogenes mCherry... -
Synthetic Biology - Assembly Standards Guide
TypeCollection...BglII Suffix: T GGATCC TAA CTCGAG Suffix Enzymes: BamHI , Xhol Scar: GGATCT Features: Scar encodes Gly-Ser...enzymes. Prohibited Restriction Sites: EcoRI, BglII, BamHI, XhoI For more info, visit iGEM: BglBrick – Berkeley... -
Immunology Research Plasmids and Resources
TypeCollection..., AMGX AMH anti-Mullerian hormone MIF, MIS AMHR2 anti-Mullerian hormone receptor, type II AMHR, MISR2,... HHT2, ORW2, SKR3, TSR-I AMHR2 anti-Mullerian hormone receptor, type II AMHR, MISR2, MISRII BMP1 bone ... -
Plasmid Modification by Annealed Oligo Cloning (with Protocols)
TypeProtocol...your favorite vector has a relatively limited MCS (BamHI - EcoRI - SalI) and you want to expand that with... -
Sequencing Primers
TypeGuide...CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI site Forward pBRforEco AATAGGCGTATCACGAGGC In pBR322...GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit ...