Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Showing: 1 - 19 of 19 results
  1. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TGACAGACTGTGGCGAGGatgccaagctggaggcGACGAAACAGGCCAGCAA amh TAL3210 & TAL3211 TCCAGGCAAGATTTGGGCtgatgctgatgatgacCGTGGCGATTGGGTCGTA...
  2. Plasmids 101: How to Verify Your Plasmid Using a Restriction Digest Analysis

    Type
    Blog Post
    ...was digested with 2 unique enzymes (HindIII and BamHI) and run on an agarose gel. The resulting gel image...the plasmid is digested with either HindIII and BamHI alone (lanes 4-5), there is a single band of 7.3...plasmid. The double digest with both HindIII and BamHI (lane 3) produces bands at 6kb and 1.2kb (red box... star activity. Some endonucleases (for example BamHI) are capable of cleaving sequences which are similar...
  3. MXS Chaining

    Type
    Blog Post
    ...SpeI and XbaI EcoRI and PstI Bglbricks BglII and BamHI EcoRI Additional Resources on the Addgene Blog...
  4. Immunology Research Plasmids and Resources

    Type
    Collection
    ..., AMGX AMH anti-Mullerian hormone MIF, MIS AMHR2 anti-Mullerian hormone receptor, type II AMHR, MISR2,... HHT2, ORW2, SKR3, TSR-I AMHR2 anti-Mullerian hormone receptor, type II AMHR, MISR2, MISRII BMP1 bone ...
  5. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pHKMC1: Empty sgRNA for Cloning 67720 Worm NotI/BamHI none S. pyogenes Colaiacovo pRB17 52527 Fly blunt...pyogenes Zack pHL-H1-ccdB-mEF1a-RiH 60601 Mammalian BamHI/EcoRI none S. pyogenes Hygro Hotta pUC-H1-gRNA 61089...pyogenes Musunuru pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI) 64217 Mammalian BbsI yes, cut S. pyogenes mCherry...
  6. Worm Expression Resources

    Type
    Collection
    ...Caenorhabditis elegans), pie-1 promoter - unique MluI/BamHI cloning site - pie-1 3'UTR (Caenorhabditis elegans...Cloning Empty vector for cloning sgRNA. NotI and BamHI for cloning sgRNA. PU6 driven sgRNA. Colaiacovo ...
  7. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    ...BglII Suffix: T GGATCC TAA CTCGAG Suffix Enzymes: BamHI , Xhol Scar: GGATCT Features: Scar encodes Gly-Ser...enzymes. Prohibited Restriction Sites: EcoRI, BglII, BamHI, XhoI For more info, visit iGEM: BglBrick – Berkeley...
  8. Luciferase Plasmids

    Type
    Collection
    ...site #1 PIM2 (Homo sapiens) Ferbeyre 51934 pGL3-alphaMHC 3300bp luciferase reporter for rat alpha-MHC promoter...NFAT-apha-MHC-Luc 9 copies of NFAT sites in minimal alphaMHC-pGL-3 9x NFAT binding site, alpha-MHC Molkentin...LATS activity by Luciferase Assay pCDNA3.1hygro-BamHI-CLuc1433-NotI Yang 107870 pClodANL-Cherry Bacterial...
  9. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...-mCherry-H1-(BamHI) Cas9 (Other), hU6 promoter; BbsI sites for sgRNA, H1 promoter; BamHI site for shRNA...sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry... vector is used for cloning a specific sgRNA by BamHI, to be co-expressed with Cas9 for genome editing...
  10. Sequencing Primers

    Type
    Guide
    ...CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI, forward primer pBRforEco AATAGGCGTATCACGAGGC In...GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI, reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit...
  11. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...2016 Jan 18. doi: 10.1038/nbt.3437. AMHR2 gRNA (BRDN0001149470) AMHR2 (Homo sapiens) Mammalian Expression...2016 Jan 18. doi: 10.1038/nbt.3437. AMHR2 gRNA (BRDN0001147673) AMHR2 (Homo sapiens) Mammalian Expression...2016 Jan 18. doi: 10.1038/nbt.3437. AMHR2 gRNA (BRDN0001149245) AMHR2 (Homo sapiens) Mammalian Expression...2016 Jan 18. doi: 10.1038/nbt.3437. AMHR2 gRNA (BRDN0001148442) AMHR2 (Homo sapiens) Mammalian Expression...
  12. Synthetic Biology - Cloning and Genomic Tools

    Type
    Collection
    ...with MCS1 EcoRV-MluI-XhoI-NheI-XbaI-NcoI-KpnI-BclI-BamHI-SalI MCS (Synthetic) Synthetic Biology Neveu MXS-Chaining...ORF's - PCR, gene synthesis or sub-clone using NdeI/BamHI. Alternatively use BsaI with CATA and TCGA fusion...
  13. CRISPR Plasmids - Parasites

    Type
    Collection
    ... vector is used for cloning a specific sgRNA by BamHI, to be co-expressed with Cas9 for genome editing...
  14. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...-mCherry-H1-(BamHI) Cas9 (Other), hU6 promoter; BbsI sites for sgRNA, H1 promoter; BamHI site for shRNA...sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry...
  15. Synthetic Biology - Mammalian

    Type
    Collection
    ...with MCS1 EcoRV-MluI-XhoI-NheI-XbaI-NcoI-KpnI-BclI-BamHI-SalI MCS (Synthetic) Synthetic Biology Neveu MXS-Chaining...
  16. Synthetic Biology - Browse Plasmids

    Type
    Collection
    ...with MCS1 EcoRV-MluI-XhoI-NheI-XbaI-NcoI-KpnI-BclI-BamHI-SalI MCS (Synthetic) Synthetic Biology Neveu MXS-Chaining...ORF's - PCR, gene synthesis or sub-clone using NdeI/BamHI. Alternatively use BsaI with CATA and TCGA fusion...
  17. Synthetic Biology - Bacterial

    Type
    Collection
    ...ORF's - PCR, gene synthesis or sub-clone using NdeI/BamHI. Alternatively use BsaI with CATA and TCGA fusion...
Showing: 1 - 19 of 19 results