...TGACAGACTGTGGCGAGGatgccaagctggaggcGACGAAACAGGCCAGCAA amh TAL3210 & TAL3211 TCCAGGCAAGATTTGGGCtgatgctgatgatgacCGTGGCGATTGGGTCGTA...

...was digested with 2 unique enzymes (HindIII and BamHI) and run on an agarose gel. The resulting gel image...the plasmid is digested with either HindIII and BamHI alone (lanes 4-5), there is a single band of 7.3...plasmid. The double digest with both HindIII and BamHI (lane 3) produces bands at 6kb and 1.2kb (red box... star activity. Some endonucleases (for example BamHI) are capable of cleaving sequences which are similar...

...recombined plasmid around 1.5 kb. When cut with BamHI, the expected linear plasmid is present, but the...

...portability, all viral genes are flanked by EcoRI and BamHI restriction sites - so cloning projects should be...

...SpeI and XbaI EcoRI and PstI Bglbricks BglII and BamHI EcoRI Additional Resources on the Addgene Blog...

...pHKMC1: Empty sgRNA for Cloning 67720 Worm NotI/BamHI none S. pyogenes Colaiacovo pRB17 52527 Fly blunt...pyogenes Zack pHL-H1-ccdB-mEF1a-RiH 60601 Mammalian BamHI/EcoRI none S. pyogenes Hygro Hotta pUC-H1-gRNA 61089...pyogenes Musunuru pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI) 64217 Mammalian BbsI yes, cut S. pyogenes mCherry...

...BglII Suffix: T GGATCC TAA CTCGAG Suffix Enzymes: BamHI , Xhol Scar: GGATCT Features: Scar encodes Gly-Ser...enzymes. Prohibited Restriction Sites: EcoRI, BglII, BamHI, XhoI For more info, visit iGEM: BglBrick – Berkeley...

..., AMGX AMH anti-Mullerian hormone MIF, MIS AMHR2 anti-Mullerian hormone receptor, type II AMHR, MISR2,... HHT2, ORW2, SKR3, TSR-I AMHR2 anti-Mullerian hormone receptor, type II AMHR, MISR2, MISRII BMP1 bone ...

...your favorite vector has a relatively limited MCS (BamHI - EcoRI - SalI) and you want to expand that with...

...CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI, forward primer pBRforEco AATAGGCGTATCACGAGGC In...GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI, reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit...