Skip to main content

We narrowed to 4 results for: c myc vectors

Showing: 1 - 4 of 4 results
  1. Sequencing Primers

    Type
    Guide
    ... promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F ...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer...pTrcHis vector, same as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance...
  2. Molecular Biology Reference

    Type
    Guide
    ... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you are looking...Thymine (T), Cytosine (C) and Guanine (G). In the double helix A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...specifically engineered plasmids, commonly referred to as vectors, which have become possibly the most ubiquitous...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...
  3. Lentiviral Vector Guide

    Type
    Guide
    ...Guides Viral Vectors Lentiviral Vector Guide Lentiviral Vector Guide Jump To: Lentiviral Vectors Lentiviral...Viral Vectors 101 topics More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...gamma-retroviruses, see Addgene's gamma-retroviral vector guide . Lentiviral Vectors The genome of lentiviruses typically..., see Addgene’s viral vector protocols . Figure 5: Overview of lentiviral vector production. Created with...Lentiviral Vectors Due to their integration and long-term expression of a transgene, lentiviral vectors are ...
  4. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Science Guides Viral Vectors Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral...gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors have selectable...of Viruses Viral Vector Elements More Viral Vectors 101 topics More Retroviral Vector topics Addgene protocols...Gamma-Retroviral Vectors Vector Production Integration Pseudotyping Common Uses Safety Resources Plasmid ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...Gamma-retroviral vectors do not have defined “generations” of plasmids, as lentiviral vectors do. For more...lentiviruses, see Addgene's lentiviral vector guide . Gamma-Retroviral Vectors The genome of gamma-retroviruses...
Showing: 1 - 4 of 4 results