We narrowed to 2 results for: c myc vectors

... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones , ...Thymine (T), Cytosine (C) and Guanine (G). In the double helix, A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...thymine, cytosine, and guanine (abbreviated to A, T, C, and G, respectively). The bases are organized into... hydrogen bonds, where A always pairs with T, and C always pairs with G. The order of nucleotides makes...another, such as from a chromosome to a plasmid or vector DNA backbone. These tools are essential to the ...