Skip to main content

We narrowed to 4 results for: c myc vectors

Showing: 1 - 4 of 4 results
  1. Sequencing Primers

    Type
    Guide
    ...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...
  2. Molecular Biology Reference

    Type
    Guide
    ... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones , ...Thymine (T), Cytosine (C) and Guanine (G). In the double helix, A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...another, such as from a chromosome to a plasmid or vector DNA backbone. These tools are essential to the ...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...
  3. Lentiviral Vector Guide

    Type
    Guide
    ...Guides Viral Vectors Lentiviral Vector Guide Lentiviral Vector Guide Jump To: Lentiviral Vectors Lentiviral...’s viral vector protocols . Figure 5: Overview of lentiviral vector production. Viral Vector Integration...Viral Vectors 101 topics More Lentiviral Vector topics Addgene Protocols pLKO.1 - TRC Cloning Vector Protocols...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...gamma-retroviruses, see Addgene's gamma-retroviral vector guide . Lentiviral Vectors The genome of lentiviruses typically...Lentiviral Vectors Due to their integration and long-term expression of a transgene, lentiviral vectors are ...
  4. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Science Guides Viral Vectors Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral...Gamma-retroviral vector packaging methods. Viral Vector Integration Much like lentiviral vectors, gamma-retroviral...gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors have selectable...of Viruses Viral Vector Elements More Viral Vectors 101 topics More Retroviral Vector topics Addgene protocols...Gamma-Retroviral Vectors Vector Production Integration Pseudotyping Common Uses Safety Resources Plasmid ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...Gamma-retroviral vectors do not have defined “generations” of plasmids, as lentiviral vectors do. For more...
Showing: 1 - 4 of 4 results